Incidental Mutation 'R7944:Zfp365'
ID612672
Institutional Source Beutler Lab
Gene Symbol Zfp365
Ensembl Gene ENSMUSG00000037855
Gene Namezinc finger protein 365
SynonymsSu48, DBZ
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7944 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location67886103-67912662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67909919 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 10 (R10W)
Ref Sequence ENSEMBL: ENSMUSP00000067197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064656]
Predicted Effect probably damaging
Transcript: ENSMUST00000064656
AA Change: R10W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067197
Gene: ENSMUSG00000037855
AA Change: R10W

DomainStartEndE-ValueType
ZnF_C2H2 26 51 4.05e-1 SMART
coiled coil region 170 298 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms which have different expression patterns and functions. Mutation in this gene is associated with uric acid nephrolithiasis (UAN). Alternatively spliced variants, encoding distinct proteins, have been identified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal cortical basket cells in the somatosensory cortices, delayed myelination in the corpus callosum during the early postnatal period, and an increase in immature oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abca4 T A 3: 122,069,248 probably null Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Zfp365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp365 APN 10 67909354 missense probably damaging 1.00
IGL03257:Zfp365 APN 10 67889038 missense possibly damaging 0.76
ANU18:Zfp365 UTSW 10 67909354 missense probably damaging 1.00
R0482:Zfp365 UTSW 10 67897606 missense probably damaging 1.00
R1800:Zfp365 UTSW 10 67888942 missense probably damaging 0.98
R1986:Zfp365 UTSW 10 67909856 missense probably damaging 1.00
R4279:Zfp365 UTSW 10 67897601 missense probably benign 0.44
R4475:Zfp365 UTSW 10 67888920 missense possibly damaging 0.87
R4951:Zfp365 UTSW 10 67889991 critical splice acceptor site probably null
R5599:Zfp365 UTSW 10 67909367 missense probably damaging 1.00
R5682:Zfp365 UTSW 10 67909807 missense probably damaging 1.00
R5697:Zfp365 UTSW 10 67909640 missense probably benign 0.01
R5837:Zfp365 UTSW 10 67889040 missense probably damaging 1.00
R5982:Zfp365 UTSW 10 67897607 missense probably damaging 1.00
R6974:Zfp365 UTSW 10 67909764 missense probably damaging 1.00
R7043:Zfp365 UTSW 10 67909826 missense probably damaging 1.00
R7861:Zfp365 UTSW 10 67909919 missense probably damaging 0.98
Z1176:Zfp365 UTSW 10 67909260 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTACTTTTCCCTGCTTCGGGAG -3'
(R):5'- CTGACTCAGTGAAACCCGTTAC -3'

Sequencing Primer
(F):5'- AGGACCTGAGAAGCTCTGTGTC -3'
(R):5'- AGACCTGTAAACTGGGGT -3'
Posted On2019-12-27