Incidental Mutation 'R7944:Brca1'
ID612677
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7944 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101526422 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 295 (N295K)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017290
AA Change: N295K

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: N295K

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abca4 T A 3: 122,069,248 probably null Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Aldh7a1 C A 18: 56,548,453 C215F probably benign Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTCAGGGCACAGACTTTGC -3'
(R):5'- TGAGTTTTCTGAGGGCATAAGAAAC -3'

Sequencing Primer
(F):5'- CACAGACTTTGCGGGTGAGTC -3'
(R):5'- TTCTGAGGGCATAAGAAACATTGAAC -3'
Posted On2019-12-27