Incidental Mutation 'R7946:Ptgs2'
ID612765
Institutional Source Beutler Lab
Gene Symbol Ptgs2
Ensembl Gene ENSMUSG00000032487
Gene Nameprostaglandin-endoperoxide synthase 2
SynonymsCox-2, PHS-2, COX2, prostaglandin G/H synthase, PGHS-2, Pghs2, Tis10, cyclooxygenase 2, cyclooxygenase-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location150100031-150108227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150101339 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 99 (M99K)
Ref Sequence ENSEMBL: ENSMUSP00000035065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
PDB Structure
CRYSTAL STRUCTURE OF ARACHIDONIC ACID BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
CYCLOOXYGENASE-2 (PROSTAGLANDIN SYNTHASE-2) COMPLEXED WITH A SELECTIVE INHIBITOR, SC-558 [X-RAY DIFFRACTION]
[]
[]
CRYSTAL STRUCTURE OF A MIXTURE OF ARACHIDONIC ACID AND PROSTAGLANDIN BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2: PROSTAGLANDIN STRUCTURE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DICLOFENAC BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of eicosapentaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of docosahexaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound in the cyclooxygenase channel of L531F murine COX-2 [X-RAY DIFFRACTION]
>> 25 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000035065
AA Change: M99K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035065
Gene: ENSMUSG00000032487
AA Change: M99K

DomainStartEndE-ValueType
EGF 20 55 2.64e1 SMART
low complexity region 182 198 N/A INTRINSIC
Pfam:An_peroxidase 206 562 7.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190784
SMART Domains Protein: ENSMUSP00000139904
Gene: ENSMUSG00000032487

DomainStartEndE-ValueType
Blast:EGF 1 23 2e-9 BLAST
SCOP:d1eqga2 1 26 5e-8 SMART
PDB:1CVU|B 1 62 1e-38 PDB
SCOP:d1cvua1 27 62 1e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Ptgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Ptgs2 APN 1 150104424 missense probably damaging 1.00
IGL01626:Ptgs2 APN 1 150103727 missense probably damaging 1.00
IGL01758:Ptgs2 APN 1 150101989 critical splice acceptor site probably null
IGL02168:Ptgs2 APN 1 150103679 unclassified probably null
IGL02309:Ptgs2 APN 1 150105556 missense probably damaging 1.00
IGL02363:Ptgs2 APN 1 150105709 unclassified probably null
IGL02574:Ptgs2 APN 1 150102775 nonsense probably null
IGL03156:Ptgs2 APN 1 150105477 missense probably damaging 1.00
R0436:Ptgs2 UTSW 1 150104277 unclassified probably benign
R0629:Ptgs2 UTSW 1 150101037 missense probably benign
R0631:Ptgs2 UTSW 1 150104537 missense probably benign 0.30
R0811:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0812:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0980:Ptgs2 UTSW 1 150104310 missense probably damaging 1.00
R1340:Ptgs2 UTSW 1 150105477 missense probably damaging 1.00
R1626:Ptgs2 UTSW 1 150103868 critical splice acceptor site probably null
R1666:Ptgs2 UTSW 1 150101270 missense probably damaging 1.00
R1742:Ptgs2 UTSW 1 150104399 missense probably damaging 1.00
R1926:Ptgs2 UTSW 1 150100228 missense possibly damaging 0.48
R2148:Ptgs2 UTSW 1 150105714 missense probably benign
R2361:Ptgs2 UTSW 1 150103975 missense probably benign 0.00
R2927:Ptgs2 UTSW 1 150101260 missense possibly damaging 0.95
R3966:Ptgs2 UTSW 1 150105475 missense probably damaging 0.99
R4291:Ptgs2 UTSW 1 150100251 missense probably benign
R4580:Ptgs2 UTSW 1 150104094 missense possibly damaging 0.78
R4668:Ptgs2 UTSW 1 150101084 missense probably benign 0.32
R4751:Ptgs2 UTSW 1 150104020 missense probably damaging 1.00
R4777:Ptgs2 UTSW 1 150105387 missense probably benign 0.03
R5264:Ptgs2 UTSW 1 150102730 missense possibly damaging 0.62
R5570:Ptgs2 UTSW 1 150104108 missense probably damaging 1.00
R5587:Ptgs2 UTSW 1 150105555 missense probably damaging 1.00
R5761:Ptgs2 UTSW 1 150105528 missense probably benign 0.18
R5850:Ptgs2 UTSW 1 150105376 missense probably benign 0.03
R6137:Ptgs2 UTSW 1 150100993 missense probably benign 0.08
R6513:Ptgs2 UTSW 1 150100128 unclassified probably benign
R6553:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6585:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6593:Ptgs2 UTSW 1 150101033 missense possibly damaging 0.63
R6772:Ptgs2 UTSW 1 150102078 missense probably damaging 1.00
R6850:Ptgs2 UTSW 1 150105540 missense probably damaging 1.00
R7205:Ptgs2 UTSW 1 150102761 missense probably benign 0.01
R7320:Ptgs2 UTSW 1 150102695 missense probably damaging 1.00
R7567:Ptgs2 UTSW 1 150102697 missense probably damaging 0.99
R7751:Ptgs2 UTSW 1 150104507 missense probably benign 0.14
R7863:Ptgs2 UTSW 1 150101339 missense probably damaging 1.00
Z1176:Ptgs2 UTSW 1 150105721 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCACATGTGTAACCATC -3'
(R):5'- TCCACACGAATGAAGGACAG -3'

Sequencing Primer
(F):5'- GGCCACATGTGTAACCATCATTCTG -3'
(R):5'- AGAGACTACAGGTTTTCATGACTG -3'
Posted On2019-12-27