Incidental Mutation 'R7946:Ago3'
ID612779
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126350197 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 721 (R721G)
Ref Sequence ENSEMBL: ENSMUSP00000066633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097] [ENSMUST00000127831] [ENSMUST00000132123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069097
AA Change: R721G

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: R721G

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127831
AA Change: R58G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000118577
Gene: ENSMUSG00000028842
AA Change: R58G

DomainStartEndE-ValueType
Piwi 1 125 9.56e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132123
AA Change: R42G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116204
Gene: ENSMUSG00000028842
AA Change: R42G

DomainStartEndE-ValueType
Piwi 1 140 1.41e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2239:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4272:Ago3 UTSW 4 126355091 missense possibly damaging 0.95
R4533:Ago3 UTSW 4 126345563 missense probably damaging 1.00
R4575:Ago3 UTSW 4 126346682 missense probably benign 0.06
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5180:Ago3 UTSW 4 126367751 missense probably benign 0.01
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126355050 missense probably damaging 1.00
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
R7077:Ago3 UTSW 4 126371532 missense probably null 0.01
R7123:Ago3 UTSW 4 126355005 critical splice donor site probably null
R7125:Ago3 UTSW 4 126370352 missense probably null 0.89
R7354:Ago3 UTSW 4 126417306 missense possibly damaging 0.72
R7472:Ago3 UTSW 4 126345517 missense probably damaging 1.00
R7522:Ago3 UTSW 4 126363807 missense probably benign 0.00
R7863:Ago3 UTSW 4 126350197 missense possibly damaging 0.53
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACATTCATGAGGCCCCAG -3'
(R):5'- GAGCTGTACAGTATGTGATGTTAAGTC -3'

Sequencing Primer
(F):5'- ATGAGGCCCCAGCATGATTTC -3'
(R):5'- AAGAGTGCTTGCAGCTCTTACAG -3'
Posted On2019-12-27