Incidental Mutation 'R7946:Espn'
ID612782
Institutional Source Beutler Lab
Gene Symbol Espn
Ensembl Gene ENSMUSG00000028943
Gene Nameespin
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R7946 (G1)
Quality Score101.008
Status Not validated
Chromosome4
Chromosomal Location152120331-152152371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152152159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 17 (V17M)
Ref Sequence ENSEMBL: ENSMUSP00000030785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030785] [ENSMUST00000105658] [ENSMUST00000105659] [ENSMUST00000135185] [ENSMUST00000207676]
Predicted Effect probably damaging
Transcript: ENSMUST00000030785
AA Change: V17M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030785
Gene: ENSMUSG00000028943
AA Change: V17M

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 605 629 N/A INTRINSIC
WH2 669 686 4.82e-3 SMART
low complexity region 714 728 N/A INTRINSIC
low complexity region 740 748 N/A INTRINSIC
coiled coil region 772 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105658
AA Change: V17M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943
AA Change: V17M

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105659
AA Change: V17M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943
AA Change: V17M

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135185
SMART Domains Protein: ENSMUSP00000122464
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 5 35 2.58e-3 SMART
ANK 39 69 1.63e0 SMART
ANK 73 103 4.97e-5 SMART
ANK 107 137 3.08e-1 SMART
ANK 141 170 9.13e-4 SMART
ANK 173 202 2.15e0 SMART
ANK 206 236 2.08e3 SMART
low complexity region 279 297 N/A INTRINSIC
low complexity region 330 367 N/A INTRINSIC
low complexity region 496 520 N/A INTRINSIC
low complexity region 533 542 N/A INTRINSIC
WH2 551 568 4.82e-3 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
coiled coil region 654 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207676
AA Change: V17M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional actin-bundling protein. It plays a major role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Mutations in this gene are associated with autosomal recessive neurosensory deafness, and autosomal dominant sensorineural deafness without vestibular involvement. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive degeneration of both inner and outer hair cells, severe deafness, vestibular dysfunction, and poor mothering ability. Heterozygotes show a progressive, age-related hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Espn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Espn APN 4 152135602 missense probably damaging 1.00
IGL01404:Espn APN 4 152138444 missense probably benign 0.03
IGL01576:Espn APN 4 152123717 missense probably damaging 1.00
R0015:Espn UTSW 4 152139152 missense possibly damaging 0.77
R1475:Espn UTSW 4 152134271 missense probably damaging 1.00
R1773:Espn UTSW 4 152128229 missense probably damaging 1.00
R1992:Espn UTSW 4 152128555 critical splice acceptor site probably null
R2014:Espn UTSW 4 152132959 splice site probably null
R2049:Espn UTSW 4 152121257 missense probably damaging 0.99
R2281:Espn UTSW 4 152135545 missense possibly damaging 0.94
R4278:Espn UTSW 4 152134417 missense probably damaging 1.00
R4527:Espn UTSW 4 152135649 missense probably damaging 0.99
R4539:Espn UTSW 4 152134208 nonsense probably null
R4621:Espn UTSW 4 152131252 missense probably damaging 1.00
R4839:Espn UTSW 4 152138504 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4998:Espn UTSW 4 152135583 missense possibly damaging 0.94
R5412:Espn UTSW 4 152128125 missense probably damaging 1.00
R5570:Espn UTSW 4 152123780 missense probably damaging 1.00
R6549:Espn UTSW 4 152131068 start codon destroyed probably null 0.99
R6551:Espn UTSW 4 152128766
R7124:Espn UTSW 4 152131264 missense probably benign 0.00
R7838:Espn UTSW 4 152131281 missense possibly damaging 0.95
R7863:Espn UTSW 4 152152159 missense probably damaging 0.99
R7921:Espn UTSW 4 152131281 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCTTAGAGTGGACTCACCTGC -3'
(R):5'- TGCAGAGCTGGAGTTGAGTC -3'

Sequencing Primer
(F):5'- TGTGTGAGCAGCCACTG -3'
(R):5'- AGTTGAGTCCCCGGGATC -3'
Posted On2019-12-27