Incidental Mutation 'R7946:Gpr12'
ID612787
Institutional Source Beutler Lab
Gene Symbol Gpr12
Ensembl Gene ENSMUSG00000041468
Gene NameG-protein coupled receptor 12
SynonymsGpcr12, Gpcr01, Gpcr20
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location146582398-146585239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146583560 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 184 (D184G)
Ref Sequence ENSEMBL: ENSMUSP00000038245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036211] [ENSMUST00000197431] [ENSMUST00000197825] [ENSMUST00000200112]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036211
AA Change: D184G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038245
Gene: ENSMUSG00000041468
AA Change: D184G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 236 2.9e-7 PFAM
Pfam:7tm_1 61 301 5.3e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197431
AA Change: D184G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142889
Gene: ENSMUSG00000041468
AA Change: D184G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 236 2.9e-7 PFAM
Pfam:7tm_1 61 301 2.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197825
SMART Domains Protein: ENSMUSP00000143415
Gene: ENSMUSG00000041468

DomainStartEndE-ValueType
Pfam:7tm_1 61 152 5.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200112
AA Change: D25G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143653
Gene: ENSMUSG00000041468
AA Change: D25G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
transmembrane domain 35 53 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in obesity, increased cholesterol, glucose and triglyceride levels and decreased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Gpr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Gpr12 APN 5 146583923 missense probably damaging 1.00
IGL03225:Gpr12 APN 5 146583951 missense probably damaging 1.00
IGL02799:Gpr12 UTSW 5 146583819 missense possibly damaging 0.92
R0380:Gpr12 UTSW 5 146583336 missense probably damaging 1.00
R0591:Gpr12 UTSW 5 146583635 missense probably benign 0.00
R0786:Gpr12 UTSW 5 146583504 missense probably damaging 0.96
R1432:Gpr12 UTSW 5 146583425 missense probably damaging 1.00
R5994:Gpr12 UTSW 5 146583431 missense probably damaging 1.00
R7069:Gpr12 UTSW 5 146583539 missense possibly damaging 0.96
R7269:Gpr12 UTSW 5 146583378 missense probably damaging 1.00
R7354:Gpr12 UTSW 5 146583962 missense probably damaging 1.00
R7863:Gpr12 UTSW 5 146583560 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTTTCCGGGTAGTCACATAGTG -3'
(R):5'- CACCATCGGACTCATTGTCG -3'

Sequencing Primer
(F):5'- TCACATAGTGCGATGTAGCC -3'
(R):5'- ATCGGACTCATTGTCGCCTCTTTC -3'
Posted On2019-12-27