Incidental Mutation 'R0689:Myo9b'
ID61280
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Namemyosin IXb
Synonyms
MMRRC Submission 038874-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R0689 (G1)
Quality Score95
Status Validated
Chromosome8
Chromosomal Location71272714-71360713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71330756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 574 (D574N)
Ref Sequence ENSEMBL: ENSMUSP00000131635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: D574N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: D574N

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168839
AA Change: D574N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: D574N

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: D574N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: D574N

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212173
Predicted Effect probably damaging
Transcript: ENSMUST00000212935
AA Change: D574N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.5848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Bpifc A G 10: 85,960,547 probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Liph T C 16: 21,968,068 Y268C probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Olfr726 A T 14: 50,084,232 F150I probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgip1 A T 4: 102,966,252 D690V probably damaging Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Snx6 A T 12: 54,763,656 S112T probably benign Het
Sox6 A G 7: 115,486,551 V685A probably damaging Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2037:Myo9b UTSW 8 71290866 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2920:Myo9b UTSW 8 71325857 missense probably damaging 0.98
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R4736:Myo9b UTSW 8 71356592 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTCCATCAGCAATAGAGCAGCC -3'
(R):5'- AGCATCCCGTGAAGATGTGCTCAG -3'

Sequencing Primer
(F):5'- agtgagggaatgggggtg -3'
(R):5'- CATGTACCTGCTGTTTACAGAG -3'
Posted On2013-07-30