Incidental Mutation 'R7946:Kmt2a'
ID612805
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Namelysine (K)-specific methyltransferase 2A
SynonymsMll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44803355-44881296 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 44809209 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000002095] [ENSMUST00000114689] [ENSMUST00000114689]
Predicted Effect probably null
Transcript: ENSMUST00000002095
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000002095
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114689
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114689
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
Chromas UTSW 9 44820342 unclassified probably benign
Heteros UTSW 9 44828811 nonsense probably null
Pyknos UTSW 9 44826828 utr 3 prime probably benign
Skies UTSW 9 44829261 utr 3 prime probably benign
spacious UTSW 9 44847645 missense probably benign 0.03
PIT4402001:Kmt2a UTSW 9 44841062 missense unknown
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 unclassified probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1785:Kmt2a UTSW 9 44819675 unclassified probably benign
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44831354 utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4888:Kmt2a UTSW 9 44821680 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44818352 unclassified probably benign
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
R7170:Kmt2a UTSW 9 44810721 missense unknown
R7202:Kmt2a UTSW 9 44847715 missense probably benign 0.03
R7481:Kmt2a UTSW 9 44809071 missense unknown
R7538:Kmt2a UTSW 9 44847744 missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44831353 missense unknown
R7741:Kmt2a UTSW 9 44808062 missense unknown
R7767:Kmt2a UTSW 9 44818998 missense unknown
R7768:Kmt2a UTSW 9 44820603 missense unknown
R7861:Kmt2a UTSW 9 44818734 missense unknown
R7894:Kmt2a UTSW 9 44849857 nonsense probably null
R7944:Kmt2a UTSW 9 44818734 missense unknown
R7977:Kmt2a UTSW 9 44849857 nonsense probably null
R7997:Kmt2a UTSW 9 44833923 missense unknown
R8033:Kmt2a UTSW 9 44845470 missense probably damaging 1.00
R8055:Kmt2a UTSW 9 44821081 missense unknown
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Z1176:Kmt2a UTSW 9 44847979 missense probably damaging 1.00
Z1177:Kmt2a UTSW 9 44819121 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTAAGCTTTGATGGCCC -3'
(R):5'- CGGGGTAGTCACTAGTGTTTAGTAC -3'

Sequencing Primer
(F):5'- TGATGGCCCCTACCTACAG -3'
(R):5'- AGAGGACCCAAGCCTGGTTTC -3'
Posted On2019-12-27