Incidental Mutation 'R7946:Tbata'
ID612808
Institutional Source Beutler Lab
Gene Symbol Tbata
Ensembl Gene ENSMUSG00000020096
Gene Namethymus, brain and testes associated
SynonymsSpatial, 1700021K02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location61171954-61188841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61175742 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 19 (E19G)
Ref Sequence ENSEMBL: ENSMUSP00000113253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035894] [ENSMUST00000079235] [ENSMUST00000121297] [ENSMUST00000122261] [ENSMUST00000126831] [ENSMUST00000131879] [ENSMUST00000140456] [ENSMUST00000143207] [ENSMUST00000148181] [ENSMUST00000151886]
Predicted Effect probably benign
Transcript: ENSMUST00000035894
AA Change: E19G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036422
Gene: ENSMUSG00000020096
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:SPATIAL 123 316 2.8e-64 PFAM
low complexity region 335 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079235
AA Change: E24G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078227
Gene: ENSMUSG00000020096
AA Change: E24G

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
Pfam:SPATIAL 128 230 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121297
AA Change: E19G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113253
Gene: ENSMUSG00000020096
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 191 2.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122261
AA Change: E19G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113902
Gene: ENSMUSG00000020096
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 282 6.7e-76 PFAM
low complexity region 301 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126831
SMART Domains Protein: ENSMUSP00000119957
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
Pfam:SPATIAL 1 155 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131879
AA Change: E19G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118942
Gene: ENSMUSG00000020096
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140456
Predicted Effect probably benign
Transcript: ENSMUST00000143207
Predicted Effect probably benign
Transcript: ENSMUST00000148181
Predicted Effect probably benign
Transcript: ENSMUST00000151886
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thymic pithelial cells and total thymocyte numbers without altering T cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Tbata
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Tbata APN 10 61175960 nonsense probably null
IGL02311:Tbata APN 10 61179455 nonsense probably null
R0417:Tbata UTSW 10 61180339 missense probably damaging 1.00
R1537:Tbata UTSW 10 61183491 splice site probably null
R1956:Tbata UTSW 10 61183477 missense probably damaging 0.99
R1959:Tbata UTSW 10 61175844 missense possibly damaging 0.86
R2138:Tbata UTSW 10 61179284 missense probably benign 0.40
R4835:Tbata UTSW 10 61183353 missense probably damaging 1.00
R6261:Tbata UTSW 10 61175865 missense possibly damaging 0.92
R6667:Tbata UTSW 10 61185363 missense probably damaging 1.00
R7355:Tbata UTSW 10 61174320 unclassified probably benign
R7863:Tbata UTSW 10 61175742 missense probably benign 0.02
X0066:Tbata UTSW 10 61188605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGGAAGACAGAGGCTCACTG -3'
(R):5'- TTAGGCGTCCAAAGCGGTAG -3'

Sequencing Primer
(F):5'- TCACTGGGACCAGATGGCATC -3'
(R):5'- GCGGTAGGCACTGGGTG -3'
Posted On2019-12-27