Incidental Mutation 'R7946:Abca7'
ID612809
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene NameATP-binding cassette, sub-family A (ABC1), member 7
SynonymsAbc51
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79996494-80015572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80008821 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1488 (D1488G)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably damaging
Transcript: ENSMUST00000043866
AA Change: D1480G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: D1480G

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132517
AA Change: D1480G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: D1480G

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171637
AA Change: D1488G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: D1488G

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 80011297 missense probably damaging 0.96
IGL01074:Abca7 APN 10 80013892 missense possibly damaging 0.88
IGL01313:Abca7 APN 10 80003123 splice site probably benign
IGL01372:Abca7 APN 10 80006255 missense probably benign 0.00
IGL01387:Abca7 APN 10 79999762 missense possibly damaging 0.71
IGL01468:Abca7 APN 10 80003877 missense probably benign 0.21
IGL01648:Abca7 APN 10 80011080 missense probably damaging 1.00
IGL01796:Abca7 APN 10 80013909 missense probably damaging 0.99
IGL01977:Abca7 APN 10 80006152 missense probably benign 0.31
IGL01982:Abca7 APN 10 80002641 missense probably damaging 1.00
IGL02115:Abca7 APN 10 79998079 missense probably damaging 1.00
IGL02437:Abca7 APN 10 80008389 missense probably damaging 1.00
IGL02721:Abca7 APN 10 80013635 missense possibly damaging 0.93
IGL02812:Abca7 APN 10 80006047 missense possibly damaging 0.84
IGL02823:Abca7 APN 10 80008822 missense probably damaging 1.00
IGL02827:Abca7 APN 10 80009865 missense probably damaging 1.00
IGL02897:Abca7 APN 10 80001592 missense probably damaging 1.00
IGL02952:Abca7 APN 10 80007408 missense probably damaging 1.00
R0507:Abca7 UTSW 10 80002821 splice site probably benign
R0528:Abca7 UTSW 10 80003014 missense probably damaging 1.00
R0541:Abca7 UTSW 10 80007351 missense probably benign 0.01
R0584:Abca7 UTSW 10 80011730 missense probably damaging 1.00
R1018:Abca7 UTSW 10 80001491 missense probably damaging 1.00
R1099:Abca7 UTSW 10 80013743 nonsense probably null
R1520:Abca7 UTSW 10 80008830 missense possibly damaging 0.69
R1536:Abca7 UTSW 10 80014230 missense probably benign 0.39
R1619:Abca7 UTSW 10 80009055 missense probably damaging 1.00
R1636:Abca7 UTSW 10 80008998 missense probably benign
R1752:Abca7 UTSW 10 80006634 missense probably benign 0.17
R1762:Abca7 UTSW 10 79999765 missense probably damaging 1.00
R1764:Abca7 UTSW 10 80008950 missense probably damaging 1.00
R1891:Abca7 UTSW 10 80005040 missense possibly damaging 0.72
R1911:Abca7 UTSW 10 80006634 missense probably benign 0.17
R2032:Abca7 UTSW 10 80008237 missense probably damaging 1.00
R2188:Abca7 UTSW 10 80002533 missense probably damaging 1.00
R2973:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R2974:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R3055:Abca7 UTSW 10 79999747 missense probably damaging 1.00
R4496:Abca7 UTSW 10 80002934 missense probably damaging 1.00
R4570:Abca7 UTSW 10 80006694 missense probably damaging 1.00
R4581:Abca7 UTSW 10 80006568 missense probably benign 0.03
R4588:Abca7 UTSW 10 79997867 splice site probably null
R4628:Abca7 UTSW 10 80015188 critical splice donor site probably null
R4641:Abca7 UTSW 10 80005781 critical splice donor site probably null
R4888:Abca7 UTSW 10 80002728 missense probably damaging 0.97
R4911:Abca7 UTSW 10 80012188 critical splice donor site probably null
R4979:Abca7 UTSW 10 80004783 nonsense probably null
R4997:Abca7 UTSW 10 80007320 missense possibly damaging 0.90
R5147:Abca7 UTSW 10 80015315 missense probably benign 0.02
R5176:Abca7 UTSW 10 79998289 missense probably benign 0.35
R5190:Abca7 UTSW 10 79999593 critical splice donor site probably null
R5358:Abca7 UTSW 10 80013331 missense probably damaging 0.99
R5409:Abca7 UTSW 10 80014320 missense probably damaging 1.00
R5705:Abca7 UTSW 10 80015442 missense probably benign
R6246:Abca7 UTSW 10 80015165 missense probably damaging 1.00
R6256:Abca7 UTSW 10 80002622 missense probably damaging 1.00
R6260:Abca7 UTSW 10 80008987 missense probably damaging 1.00
R6275:Abca7 UTSW 10 79997791 missense probably damaging 1.00
R6277:Abca7 UTSW 10 80006158 missense probably benign 0.04
R6284:Abca7 UTSW 10 80004410 missense probably benign
R6307:Abca7 UTSW 10 80007387 missense probably damaging 1.00
R6451:Abca7 UTSW 10 80006899 missense probably damaging 0.99
R6456:Abca7 UTSW 10 80015150 missense probably null 0.69
R6460:Abca7 UTSW 10 80009028 missense probably benign 0.04
R6560:Abca7 UTSW 10 80007396 missense probably damaging 1.00
R6565:Abca7 UTSW 10 80011788 missense probably damaging 1.00
R6644:Abca7 UTSW 10 80008764 missense probably damaging 0.98
R6814:Abca7 UTSW 10 80002999 missense probably damaging 1.00
R7289:Abca7 UTSW 10 80009944 missense probably damaging 1.00
R7303:Abca7 UTSW 10 80014988 missense probably benign 0.17
R7493:Abca7 UTSW 10 80002062 missense probably damaging 0.96
R7535:Abca7 UTSW 10 80001629 missense probably benign 0.04
R7602:Abca7 UTSW 10 79998012 critical splice acceptor site probably null
R7607:Abca7 UTSW 10 80011833 missense probably damaging 1.00
R7647:Abca7 UTSW 10 80000822 missense probably benign 0.00
R7821:Abca7 UTSW 10 80002590 small deletion probably benign
R7863:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7896:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7911:Abca7 UTSW 10 80005033 missense probably benign 0.00
R7979:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7992:Abca7 UTSW 10 80005033 missense probably benign 0.00
Z1176:Abca7 UTSW 10 79999432 nonsense probably null
Z1176:Abca7 UTSW 10 80006559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACCATTTCCCAGATATGG -3'
(R):5'- GCTGCTCCTTGGTCAAGTTC -3'

Sequencing Primer
(F):5'- CCAGATATGGGGGCTTCTCC -3'
(R):5'- CTCCTTGGTCAAGTTCAAAGGATG -3'
Posted On2019-12-27