Incidental Mutation 'R7946:Ephx2'
ID612824
Institutional Source Beutler Lab
Gene Symbol Ephx2
Ensembl Gene ENSMUSG00000022040
Gene Nameepoxide hydrolase 2, cytoplasmic
SynonymsEph2, sEP, sEH
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R7946 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location66084374-66124500 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 66107243 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 211 (R211*)
Ref Sequence ENSEMBL: ENSMUSP00000069209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070515] [ENSMUST00000224698] [ENSMUST00000225309]
PDB Structure
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CPU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CIU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CDU INHIBITOR [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000070515
AA Change: R211*
SMART Domains Protein: ENSMUSP00000069209
Gene: ENSMUSG00000022040
AA Change: R211*

DomainStartEndE-ValueType
Pfam:Hydrolase 3 197 1.2e-8 PFAM
Pfam:HAD_2 6 203 2.5e-17 PFAM
Pfam:Hydrolase_4 256 529 6.6e-11 PFAM
Pfam:Abhydrolase_1 257 530 7.2e-38 PFAM
Pfam:Abhydrolase_5 258 524 3.5e-14 PFAM
Pfam:Abhydrolase_6 259 536 2.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224698
AA Change: R193*
Predicted Effect probably null
Transcript: ENSMUST00000225309
AA Change: R145*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Males homozygous for a targeted null mutation display a significant reduction in blood pressure both in the absence and presence of dietary salt loading. Both sexes exhibit altered arachidonic acid metabolism and reduced renal formation of epoxyeicosatrienoic and dihydroxyeicosatrienoic acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Grcc10 A T 6: 124,739,247 probably null Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Il1rap C T 16: 26,676,711 R23C probably damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Kmt2a A T 9: 44,809,209 probably null Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Prl2b1 G T 13: 27,388,426 probably null Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Ephx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ephx2 APN 14 66092837 missense probably benign
IGL01143:Ephx2 APN 14 66089522 missense probably damaging 1.00
IGL02058:Ephx2 APN 14 66103724 critical splice donor site probably null
IGL02164:Ephx2 APN 14 66103720 splice site probably benign
IGL02606:Ephx2 APN 14 66086292 missense probably damaging 1.00
PIT4618001:Ephx2 UTSW 14 66102222 missense probably damaging 0.99
R0396:Ephx2 UTSW 14 66108063 missense probably benign 0.03
R0732:Ephx2 UTSW 14 66086963 critical splice donor site probably null
R0762:Ephx2 UTSW 14 66102179 missense probably damaging 1.00
R1444:Ephx2 UTSW 14 66107320 missense probably damaging 1.00
R1689:Ephx2 UTSW 14 66087026 nonsense probably null
R1735:Ephx2 UTSW 14 66088303 missense probably benign
R1871:Ephx2 UTSW 14 66084734 missense probably damaging 1.00
R4210:Ephx2 UTSW 14 66084944 missense probably damaging 1.00
R5130:Ephx2 UTSW 14 66108062 missense probably damaging 0.97
R5800:Ephx2 UTSW 14 66107302 missense probably benign 0.38
R6013:Ephx2 UTSW 14 66110242 missense probably benign 0.19
R6076:Ephx2 UTSW 14 66092848 missense probably damaging 1.00
R6193:Ephx2 UTSW 14 66089512 missense probably benign 0.01
R6193:Ephx2 UTSW 14 66112220 missense probably benign 0.12
R7324:Ephx2 UTSW 14 66085354 missense probably damaging 1.00
R7390:Ephx2 UTSW 14 66110455
R7504:Ephx2 UTSW 14 66101617 missense probably damaging 0.99
R7759:Ephx2 UTSW 14 66089519 missense possibly damaging 0.67
R7814:Ephx2 UTSW 14 66110229 missense probably benign 0.09
R7863:Ephx2 UTSW 14 66107243 nonsense probably null
R8003:Ephx2 UTSW 14 66124333 critical splice donor site probably null
RF023:Ephx2 UTSW 14 66084929 critical splice donor site probably null
Z1088:Ephx2 UTSW 14 66107318 missense probably benign 0.00
Z1177:Ephx2 UTSW 14 66085325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTAGTTTCCTAGCTTGCCAAAC -3'
(R):5'- TTCCTGCTGCCACAAGATG -3'

Sequencing Primer
(F):5'- ACATTGGTTTAAACTCCCACTTACTG -3'
(R):5'- ACCATCCCTGAGGGTCCATG -3'
Posted On2019-12-27