Incidental Mutation 'R7947:Prss54'
ID612865
Institutional Source Beutler Lab
Gene Symbol Prss54
Ensembl Gene ENSMUSG00000048400
Gene Nameprotease, serine 54
Synonyms4931432M23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7947 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95559069-95576340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95559669 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 259 (K259E)
Ref Sequence ENSEMBL: ENSMUSP00000058859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041569] [ENSMUST00000052690] [ENSMUST00000180075] [ENSMUST00000213096]
Predicted Effect probably benign
Transcript: ENSMUST00000041569
SMART Domains Protein: ENSMUSP00000049497
Gene: ENSMUSG00000036598

DomainStartEndE-ValueType
coiled coil region 95 139 N/A INTRINSIC
Pfam:DUF4201 178 354 6.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052690
AA Change: K259E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058859
Gene: ENSMUSG00000048400
AA Change: K259E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 28 253 1.88e-15 SMART
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180075
AA Change: K259E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137577
Gene: ENSMUSG00000048400
AA Change: K259E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 28 253 1.63e-15 SMART
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213096
AA Change: K259E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative serine-type endopeptidase containing the peptidase S1 domain. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Prss54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02340:Prss54 APN 8 95565609 missense probably benign 0.17
IGL02598:Prss54 APN 8 95565709 missense probably damaging 0.99
IGL03085:Prss54 APN 8 95565630 missense probably benign 0.02
R0324:Prss54 UTSW 8 95565667 missense probably benign 0.00
R0733:Prss54 UTSW 8 95559740 missense possibly damaging 0.90
R1487:Prss54 UTSW 8 95559648 missense probably benign 0.01
R2272:Prss54 UTSW 8 95571107 nonsense probably null
R4769:Prss54 UTSW 8 95559375 missense probably benign
R5275:Prss54 UTSW 8 95564478 missense probably damaging 1.00
R5295:Prss54 UTSW 8 95564478 missense probably damaging 1.00
R6117:Prss54 UTSW 8 95565458 splice site probably null
R6167:Prss54 UTSW 8 95559545 missense possibly damaging 0.71
R6791:Prss54 UTSW 8 95564655 intron probably null
R7179:Prss54 UTSW 8 95565571 missense probably benign 0.03
R7261:Prss54 UTSW 8 95559739 missense probably benign 0.02
R7864:Prss54 UTSW 8 95559669 missense probably benign 0.22
Z1177:Prss54 UTSW 8 95564451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCCTGTTTACCCTGAAG -3'
(R):5'- CTGAGACCTGAAGCCTTATTCTG -3'

Sequencing Primer
(F):5'- ACCCTGAAGTTCTGCCCAG -3'
(R):5'- GTCCTTTACTGCAGGGGGAAC -3'
Posted On2019-12-27