Incidental Mutation 'R0689:Bpifc'
ID61287
Institutional Source Beutler Lab
Gene Symbol Bpifc
Ensembl Gene ENSMUSG00000050108
Gene NameBPI fold containing family C
SynonymsBpil2
MMRRC Submission 038874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0689 (G1)
Quality Score139
Status Validated
Chromosome10
Chromosomal Location85959340-86011895 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 85960547 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001834] [ENSMUST00000061699]
Predicted Effect probably benign
Transcript: ENSMUST00000001834
SMART Domains Protein: ENSMUSP00000001834
Gene: ENSMUSG00000001783

DomainStartEndE-ValueType
Pfam:RtcB 61 505 3.3e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061699
SMART Domains Protein: ENSMUSP00000063107
Gene: ENSMUSG00000050108

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
BPI1 33 257 8.89e-23 SMART
BPI2 272 474 2.29e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139413
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Liph T C 16: 21,968,068 Y268C probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myo9b G A 8: 71,330,756 D574N probably damaging Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Olfr726 A T 14: 50,084,232 F150I probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgip1 A T 4: 102,966,252 D690V probably damaging Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Snx6 A T 12: 54,763,656 S112T probably benign Het
Sox6 A G 7: 115,486,551 V685A probably damaging Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Bpifc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Bpifc APN 10 85960528 missense possibly damaging 0.85
IGL01474:Bpifc APN 10 86000639 start codon destroyed probably damaging 0.98
IGL02437:Bpifc APN 10 85988731 missense probably damaging 1.00
R1205:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R1524:Bpifc UTSW 10 85977735 missense probably benign 0.01
R2033:Bpifc UTSW 10 86000632 missense possibly damaging 0.88
R3103:Bpifc UTSW 10 85993422 missense probably damaging 1.00
R3609:Bpifc UTSW 10 86000638 start codon destroyed probably null 1.00
R3874:Bpifc UTSW 10 85991254 missense probably benign
R4728:Bpifc UTSW 10 85991199 missense possibly damaging 0.50
R5079:Bpifc UTSW 10 85981304 missense probably damaging 1.00
R5193:Bpifc UTSW 10 86000633 missense probably benign 0.01
R6280:Bpifc UTSW 10 85977712 missense probably benign 0.02
R6291:Bpifc UTSW 10 85976258 missense probably damaging 1.00
R6945:Bpifc UTSW 10 85979214 missense probably benign 0.00
R7288:Bpifc UTSW 10 85988721 missense possibly damaging 0.95
R7310:Bpifc UTSW 10 85963027 missense probably damaging 1.00
R7463:Bpifc UTSW 10 85979334 missense probably benign 0.00
R7807:Bpifc UTSW 10 85976250 missense possibly damaging 0.80
R8004:Bpifc UTSW 10 85979284 missense probably benign
R8225:Bpifc UTSW 10 86000567 missense probably benign 0.00
Z1176:Bpifc UTSW 10 85965228 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGACTGAAGGCTGTTTACTTCCTG -3'
(R):5'- GCGACCGATTGAAGGCTACTTTCTG -3'

Sequencing Primer
(F):5'- CCTGGGGTGTATTGTGAGC -3'
(R):5'- ACTAGTGGACACTTCCTCATAGC -3'
Posted On2013-07-30