Incidental Mutation 'R7947:Foxa1'
ID612877
Institutional Source Beutler Lab
Gene Symbol Foxa1
Ensembl Gene ENSMUSG00000035451
Gene Nameforkhead box A1
SynonymsHnf3a, Hnf-3a, Tcf3a, Tcf-3a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7947 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location57540628-57546916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57542747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 229 (V229D)
Ref Sequence ENSEMBL: ENSMUSP00000041118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044380]
Predicted Effect probably damaging
Transcript: ENSMUST00000044380
AA Change: V229D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041118
Gene: ENSMUSG00000035451
AA Change: V229D

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
FH 168 258 3.88e-62 SMART
low complexity region 273 286 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
Pfam:HNF_C 393 457 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal feeding, hypoglycemia, impaired glucagon secretion, hypotryglyceridemia, wasting, and lethality between postnatal days 2 and 14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Foxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Foxa1 APN 12 57542657 missense probably damaging 1.00
IGL02371:Foxa1 APN 12 57542700 missense probably damaging 0.98
IGL03150:Foxa1 APN 12 57542296 missense probably benign 0.41
PIT4377001:Foxa1 UTSW 12 57542781 missense probably damaging 1.00
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1347:Foxa1 UTSW 12 57542284 missense probably damaging 0.99
R1494:Foxa1 UTSW 12 57542198 missense probably damaging 0.99
R1598:Foxa1 UTSW 12 57542687 missense possibly damaging 0.69
R1809:Foxa1 UTSW 12 57542741 missense probably damaging 1.00
R5554:Foxa1 UTSW 12 57542291 missense probably benign 0.00
R5667:Foxa1 UTSW 12 57542295 missense probably benign 0.01
R5782:Foxa1 UTSW 12 57542516 missense probably benign 0.00
R6174:Foxa1 UTSW 12 57542900 missense probably damaging 1.00
R6750:Foxa1 UTSW 12 57542610 missense probably benign 0.32
R6781:Foxa1 UTSW 12 57543257 missense possibly damaging 0.74
R6995:Foxa1 UTSW 12 57542478 missense probably benign 0.00
R7209:Foxa1 UTSW 12 57543291 missense probably benign 0.03
R7864:Foxa1 UTSW 12 57542747 missense probably damaging 1.00
X0020:Foxa1 UTSW 12 57543312 missense possibly damaging 0.73
Z1177:Foxa1 UTSW 12 57542417 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGACTTCAACTCCGAAGCG -3'
(R):5'- GCCAAGACATTCAAGCGCAG -3'

Sequencing Primer
(F):5'- CGCTGTGGTCCAGAGTCTG -3'
(R):5'- GCCAAGCCGCCTTACTC -3'
Posted On2019-12-27