Incidental Mutation 'R7949:Ttc6'
ID612942
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Nametetratricopeptide repeat domain 6
SynonymsEG639426, LOC217602, Gm9813
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7949 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location57564113-57737928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57674649 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 975 (A975T)
Ref Sequence ENSEMBL: ENSMUSP00000134273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172939]
Predicted Effect probably damaging
Transcript: ENSMUST00000172939
AA Change: A975T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: A975T

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,098,295 R194* probably null Het
Actl6a A G 3: 32,712,113 T39A possibly damaging Het
Adamts6 T A 13: 104,413,749 C624* probably null Het
Adgrl1 T C 8: 83,937,935 probably null Het
Ap3m2 A G 8: 22,799,658 V143A probably benign Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Aqp5 T A 15: 99,591,543 V91E probably damaging Het
Atp6v0b A T 4: 117,885,153 I181N probably damaging Het
Ccp110 T A 7: 118,723,018 M632K probably benign Het
Cd44 A T 2: 102,842,259 probably null Het
Cidea G A 18: 67,358,784 R38Q probably damaging Het
Cnn3 T C 3: 121,451,393 I86T probably benign Het
Col14a1 C A 15: 55,388,620 D557E unknown Het
Col6a6 T C 9: 105,689,561 Y2245C probably damaging Het
Dhrs4 A T 14: 55,487,635 N196Y probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dpep2 T C 8: 105,989,481 T267A Het
Dtx3l T A 16: 35,938,750 Q43L probably benign Het
Ednrb A G 14: 103,843,302 S59P probably benign Het
Eml4 A G 17: 83,450,697 T435A probably benign Het
Fam135b A T 15: 71,462,076 F1090I probably benign Het
Filip1 A G 9: 79,818,943 V798A probably benign Het
Fnip1 T G 11: 54,465,402 probably benign Het
Gabrb2 C T 11: 42,487,223 Q89* probably null Het
Gm960 T A 19: 4,698,486 R61S unknown Het
Gtf2ird1 A T 5: 134,363,209 V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 M1K probably null Het
Igkv10-96 T A 6: 68,632,041 D90V possibly damaging Het
Igkv4-54 G A 6: 69,631,756 R60C probably benign Het
Igkv7-33 G T 6: 70,058,863 A45D probably damaging Het
Itga7 T A 10: 128,941,252 probably null Het
Klk1b22 A T 7: 44,112,744 I15F possibly damaging Het
Lamp3 T A 16: 19,699,740 D249V probably benign Het
Lrrfip2 T C 9: 111,193,081 V125A possibly damaging Het
Mprip G A 11: 59,752,930 R638H possibly damaging Het
Muc5ac A G 7: 141,795,852 M501V probably benign Het
Myo5a C T 9: 75,203,752 P1509S probably damaging Het
Ngdn A G 14: 55,021,097 Y63C probably damaging Het
Oit3 A G 10: 59,424,030 V517A probably benign Het
Olfr935 A T 9: 38,994,731 S235T not run Het
Pcdhb18 T A 18: 37,490,459 F281I probably damaging Het
Pkd1 C A 17: 24,590,907 Q3520K probably benign Het
Plxnb1 T A 9: 109,100,457 I127N probably damaging Het
Ppfia2 A T 10: 106,819,529 N319I probably damaging Het
Pxn T C 5: 115,548,606 S386P possibly damaging Het
Ralgps2 C T 1: 156,887,168 V104I probably benign Het
Rp1 C T 1: 4,347,701 V1063I probably benign Het
Slc10a5 A T 3: 10,334,472 F376Y probably damaging Het
Snd1 T A 6: 28,527,725 I277N probably damaging Het
Spc25 A G 2: 69,206,062 probably null Het
Tex29 A G 8: 11,844,055 N6D unknown Het
Tln1 C T 4: 43,536,148 probably null Het
Ttc30b A G 2: 75,936,619 S597P possibly damaging Het
Uba6 T C 5: 86,172,701 E13G probably damaging Het
Ugcg T G 4: 59,211,927 C98G possibly damaging Het
Ugt2b36 T A 5: 87,092,331 D65V probably damaging Het
Unc93b1 A T 19: 3,935,243 D17V not run Het
Usf1 G T 1: 171,417,894 W291C unknown Het
Vps29 T C 5: 122,362,117 W97R possibly damaging Het
Zbtb6 T C 2: 37,429,565 E117G probably damaging Het
Zfp735 A C 11: 73,710,803 D191A probably benign Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57686346 missense probably benign 0.14
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57649506 missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5402:Ttc6 UTSW 12 57737031 nonsense probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57737616 missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57696986 missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7430:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7492:Ttc6 UTSW 12 57673136 missense probably benign 0.02
R7535:Ttc6 UTSW 12 57576519 missense probably benign 0.00
R7866:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7901:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R7984:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R8062:Ttc6 UTSW 12 57736978 missense possibly damaging 0.90
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Z1176:Ttc6 UTSW 12 57697375 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGAGTATTCAGACTCTGAGGGG -3'
(R):5'- ATGCCAGCAATGGAAGTTCTG -3'

Sequencing Primer
(F):5'- TTCAGACTCTGAGGGGGAAAATAAG -3'
(R):5'- ACTCTTAAGGGCTTTACAAGGG -3'
Posted On2019-12-27