Incidental Mutation 'R0689:Olfr726'
ID61295
Institutional Source Beutler Lab
Gene Symbol Olfr726
Ensembl Gene ENSMUSG00000060523
Gene Nameolfactory receptor 726
SynonymsMOR246-4, GA_x6K02T2PMLR-5775299-5774334
MMRRC Submission 038874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0689 (G1)
Quality Score98
Status Validated
Chromosome14
Chromosomal Location50083570-50090953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50084232 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 150 (F150I)
Ref Sequence ENSEMBL: ENSMUSP00000149373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072370] [ENSMUST00000206834] [ENSMUST00000213345] [ENSMUST00000215105] [ENSMUST00000215278] [ENSMUST00000217025] [ENSMUST00000217319] [ENSMUST00000217422]
Predicted Effect probably benign
Transcript: ENSMUST00000072370
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072207
Gene: ENSMUSG00000060523
AA Change: F150I

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 288 5.4e-8 PFAM
Pfam:7tm_1 41 287 7.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205951
AA Change: F150I
Predicted Effect probably benign
Transcript: ENSMUST00000206834
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000213345
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000215105
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000215278
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217025
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217319
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217422
AA Change: F150I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Bpifc A G 10: 85,960,547 probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Liph T C 16: 21,968,068 Y268C probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myo9b G A 8: 71,330,756 D574N probably damaging Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgip1 A T 4: 102,966,252 D690V probably damaging Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Snx6 A T 12: 54,763,656 S112T probably benign Het
Sox6 A G 7: 115,486,551 V685A probably damaging Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Olfr726
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr726 APN 14 50083997 missense probably benign 0.00
IGL01432:Olfr726 APN 14 50083947 missense probably benign 0.07
IGL01788:Olfr726 APN 14 50084502 missense probably damaging 1.00
IGL01957:Olfr726 APN 14 50084280 missense probably benign 0.00
IGL02132:Olfr726 APN 14 50084486 missense probably damaging 1.00
R0611:Olfr726 UTSW 14 50083853 missense probably damaging 1.00
R1556:Olfr726 UTSW 14 50084459 missense possibly damaging 0.90
R1710:Olfr726 UTSW 14 50084370 missense probably benign 0.01
R1791:Olfr726 UTSW 14 50084042 missense probably benign 0.03
R1804:Olfr726 UTSW 14 50083902 missense probably damaging 0.99
R1853:Olfr726 UTSW 14 50084120 missense probably damaging 1.00
R2034:Olfr726 UTSW 14 50083983 missense probably benign 0.34
R3155:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3156:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3939:Olfr726 UTSW 14 50083716 makesense probably null
R4392:Olfr726 UTSW 14 50084603 missense probably benign 0.24
R4533:Olfr726 UTSW 14 50083699 unclassified probably null
R4694:Olfr726 UTSW 14 50084019 missense probably benign
R5183:Olfr726 UTSW 14 50084546 missense probably damaging 0.99
R5859:Olfr726 UTSW 14 50084027 missense probably damaging 1.00
R6186:Olfr726 UTSW 14 50084525 missense probably damaging 0.98
R6357:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6771:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6834:Olfr726 UTSW 14 50084228 missense probably damaging 0.99
R6924:Olfr726 UTSW 14 50083850 missense possibly damaging 0.91
R8043:Olfr726 UTSW 14 50083910 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGATAGCGACCCCTCAGCTTTGAC -3'
(R):5'- TGAAGCCTGCTTGGCTCAGATTTTC -3'

Sequencing Primer
(F):5'- TGTACTCAGGGTGAGAACTCC -3'
(R):5'- CTGTGTCCATCAATTTGCTGG -3'
Posted On2013-07-30