Incidental Mutation 'R0689:Liph'
ID61299
Institutional Source Beutler Lab
Gene Symbol Liph
Ensembl Gene ENSMUSG00000044626
Gene Namelipase, member H
SynonymsD16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr
MMRRC Submission 038874-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0689 (G1)
Quality Score122
Status Validated
Chromosome16
Chromosomal Location21953817-21995663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21968068 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 268 (Y268C)
Ref Sequence ENSEMBL: ENSMUSP00000062310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]
Predicted Effect probably damaging
Transcript: ENSMUST00000060673
AA Change: Y268C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: Y268C

DomainStartEndE-ValueType
Pfam:Lipase 11 326 6.8e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074230
AA Change: Y238C

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: Y238C

DomainStartEndE-ValueType
Pfam:Lipase 15 214 1.5e-45 PFAM
Pfam:Abhydrolase_6 73 296 2.3e-6 PFAM
Pfam:Lipase 209 296 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231682
Predicted Effect possibly damaging
Transcript: ENSMUST00000231766
AA Change: Y266C

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232673
Meta Mutation Damage Score 0.8801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Bpifc A G 10: 85,960,547 probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myo9b G A 8: 71,330,756 D574N probably damaging Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Olfr726 A T 14: 50,084,232 F150I probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgip1 A T 4: 102,966,252 D690V probably damaging Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Snx6 A T 12: 54,763,656 S112T probably benign Het
Sox6 A G 7: 115,486,551 V685A probably damaging Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Liph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Liph APN 16 21968140 missense probably damaging 1.00
babyback UTSW 16 21983957 missense probably damaging 0.97
PIT4131001:Liph UTSW 16 21995369 start codon destroyed probably null 0.59
R0004:Liph UTSW 16 21984194 nonsense probably null
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0348:Liph UTSW 16 21967980 splice site probably null
R0715:Liph UTSW 16 21995350 missense probably benign 0.05
R1104:Liph UTSW 16 21984148 missense possibly damaging 0.82
R1779:Liph UTSW 16 21968050 missense probably benign 0.01
R2323:Liph UTSW 16 21984004 missense probably damaging 0.99
R3913:Liph UTSW 16 21962259 splice site probably benign
R4402:Liph UTSW 16 21976250 missense probably damaging 1.00
R4454:Liph UTSW 16 21984268 missense probably benign 0.11
R4672:Liph UTSW 16 21984056 missense probably benign 0.14
R4681:Liph UTSW 16 21984027 missense probably benign 0.02
R5111:Liph UTSW 16 21984070 missense probably damaging 1.00
R5135:Liph UTSW 16 21956165 nonsense probably null
R5235:Liph UTSW 16 21984035 missense probably damaging 1.00
R5642:Liph UTSW 16 21965995 missense possibly damaging 0.61
R5810:Liph UTSW 16 21968110 missense probably damaging 1.00
R6188:Liph UTSW 16 21984268 missense probably benign 0.11
R6557:Liph UTSW 16 21983920 missense possibly damaging 0.60
R6734:Liph UTSW 16 21983957 missense probably damaging 0.97
R7011:Liph UTSW 16 21984097 missense probably damaging 0.98
R7038:Liph UTSW 16 21976259 missense probably damaging 1.00
R7178:Liph UTSW 16 21976328 missense probably damaging 1.00
R7185:Liph UTSW 16 21995339 missense probably benign 0.00
R7198:Liph UTSW 16 21966022 missense probably damaging 1.00
R7775:Liph UTSW 16 21958914 missense probably damaging 1.00
R7832:Liph UTSW 16 21962236 missense probably benign 0.01
R7993:Liph UTSW 16 21958812 missense probably benign 0.03
R8264:Liph UTSW 16 21983971 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGCTAAGCTGTAATGCCCTATCC -3'
(R):5'- GCATTCAGGAGGTGTGGTCAAACG -3'

Sequencing Primer
(F):5'- caacctaagctaaagagcaagac -3'
(R):5'- AGGTGTGGTCAAACGTGGTG -3'
Posted On2013-07-30