Mutagenetix > Incidental Mutations

Incidental Mutation 'R0689:Liph'

61299

Institutional Source

Beutler Lab

Gene Symbol

Liph

Ensembl Gene

ENSMUSG00000044626

Gene Name

lipase, member H

Synonyms

D16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr

MMRRC Submission

038874-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0689 (G1)

Quality Score

122

Status

Validated

Chromosome

Chromosomal Location

21953817-21995663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21968068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 268 (Y268C)

Ref Sequence

ENSEMBL: ENSMUSP00000062310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]

AlphaFold

Q8CIV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000060673
AA Change: Y268C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: Y268C

Domain	Start	End	E-Value	Type
Pfam:Lipase	11	326	6.8e-82	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074230
AA Change: Y238C

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: Y238C

Domain	Start	End	E-Value	Type
Pfam:Lipase	15	214	1.5e-45	PFAM
Pfam:Abhydrolase_6	73	296	2.3e-6	PFAM
Pfam:Lipase	209	296	1.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231682

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231766
AA Change: Y266C

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232120

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232673

Meta Mutation Damage Score

0.8801

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.4%
20x: 91.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	C	A	7: 28,897,049	G674W	probably damaging	Het
Adcy9	A	G	16: 4,312,804		probably benign	Het
Adgrv1	C	T	13: 81,475,105	V3800I	possibly damaging	Het
Agl	A	G	3: 116,793,628	Y93H	probably damaging	Het
Aldh1a3	T	A	7: 66,402,005	D400V	probably benign	Het
Bpifc	A	G	10: 85,960,547		probably benign	Het
Cachd1	G	T	4: 100,974,876	R745L	probably damaging	Het
Cadm3	T	A	1: 173,344,452	T185S	possibly damaging	Het
Cep85l	G	T	10: 53,348,847	D215E	probably damaging	Het
Ces1g	A	G	8: 93,328,407	S221P	probably damaging	Het
Cfap206	C	T	4: 34,722,668	V138M	probably benign	Het
Csmd3	A	T	15: 47,756,025	F1714I	probably benign	Het
Cyp4f18	A	G	8: 71,995,968	L279P	probably benign	Het
Dnah7a	G	A	1: 53,620,681	Q723*	probably null	Het
Dnaja2	A	G	8: 85,546,718		probably benign	Het
Dnajc6	T	C	4: 101,611,253	V162A	possibly damaging	Het
Dok4	T	C	8: 94,870,919	T3A	probably benign	Het
Efcab7	T	C	4: 99,904,784	W424R	probably damaging	Het
Fah	A	T	7: 84,593,184		probably null	Het
Fam120a	T	C	13: 48,967,638	D64G	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gas8	T	G	8: 123,524,106	L106R	probably damaging	Het
Gykl1	T	G	18: 52,694,051	N110K	possibly damaging	Het
Hsd3b3	G	T	3: 98,741,979	L343I	possibly damaging	Het
Itch	T	A	2: 155,182,178	S234T	possibly damaging	Het
Itgbl1	A	T	14: 123,827,847	I61F	possibly damaging	Het
Klf6	T	A	13: 5,865,116	S185T	probably damaging	Het
Klk1b1	A	C	7: 43,970,719	K202T	probably benign	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Myo9b	G	A	8: 71,330,756	D574N	probably damaging	Het
Nfyb	G	A	10: 82,755,002	A65V	possibly damaging	Het
Nipbl	A	G	15: 8,293,078		probably null	Het
Olfm3	T	A	3: 115,122,545	N355K	probably benign	Het
Olfr726	A	T	14: 50,084,232	F150I	probably benign	Het
Pcdhb21	A	G	18: 37,515,317	T500A	probably benign	Het
Pclo	A	G	5: 14,714,019	I4169V	unknown	Het
Pde4d	T	C	13: 109,740,544	S144P	possibly damaging	Het
Pgghg	T	C	7: 140,943,278	Y157H	probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pla2g12a	T	C	3: 129,881,298		probably null	Het
Ppp1r14d	T	C	2: 119,229,612	D63G	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgip1	A	T	4: 102,966,252	D690V	probably damaging	Het
Skp1a	T	C	11: 52,243,765		probably benign	Het
Slc25a12	T	C	2: 71,311,493	Y272C	possibly damaging	Het
Slc37a2	A	G	9: 37,235,550		probably benign	Het
Snx6	A	T	12: 54,763,656	S112T	probably benign	Het
Sox6	A	G	7: 115,486,551	V685A	probably damaging	Het
Taf2	A	T	15: 55,063,065	V163E	possibly damaging	Het
Tg	A	T	15: 66,839,404		probably benign	Het
Tmem30c	A	G	16: 57,270,173	Y224H	probably damaging	Het
Tmem45b	T	C	9: 31,428,583	N173D	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trerf1	C	T	17: 47,319,374		noncoding transcript	Het
Triobp	A	T	15: 78,959,988	K135*	probably null	Het
Ttll9	T	A	2: 152,983,127	D75E	probably benign	Het
Vmn1r63	T	C	7: 5,803,610	I8V	probably benign	Het
Vmn2r77	A	T	7: 86,811,664	I733F	probably damaging	Het
Vmn2r98	T	C	17: 19,080,520	S595P	possibly damaging	Het
Zcchc2	C	T	1: 106,030,504	Q504*	probably null	Het
Zfp2	T	C	11: 50,900,907	D103G	probably benign	Het
Zfp59	A	G	7: 27,853,717	K198R	probably benign	Het
Zfp64	C	A	2: 168,935,201		probably benign	Het

Other mutations in Liph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Liph	APN	16	21968140	missense	probably damaging	1.00
babyback	UTSW	16	21983957	missense	probably damaging	0.97
PIT4131001:Liph	UTSW	16	21995369	start codon destroyed	probably null	0.59
R0004:Liph	UTSW	16	21984194	nonsense	probably null
R0045:Liph	UTSW	16	21968053	missense	probably damaging	1.00
R0045:Liph	UTSW	16	21968053	missense	probably damaging	1.00
R0348:Liph	UTSW	16	21967980	splice site	probably null
R0715:Liph	UTSW	16	21995350	missense	probably benign	0.05
R1104:Liph	UTSW	16	21984148	missense	possibly damaging	0.82
R1779:Liph	UTSW	16	21968050	missense	probably benign	0.01
R2323:Liph	UTSW	16	21984004	missense	probably damaging	0.99
R3913:Liph	UTSW	16	21962259	splice site	probably benign
R4402:Liph	UTSW	16	21976250	missense	probably damaging	1.00
R4454:Liph	UTSW	16	21984268	missense	probably benign	0.11
R4672:Liph	UTSW	16	21984056	missense	probably benign	0.14
R4681:Liph	UTSW	16	21984027	missense	probably benign	0.02
R5111:Liph	UTSW	16	21984070	missense	probably damaging	1.00
R5135:Liph	UTSW	16	21956165	nonsense	probably null
R5235:Liph	UTSW	16	21984035	missense	probably damaging	1.00
R5642:Liph	UTSW	16	21965995	missense	possibly damaging	0.61
R5810:Liph	UTSW	16	21968110	missense	probably damaging	1.00
R6188:Liph	UTSW	16	21984268	missense	probably benign	0.11
R6557:Liph	UTSW	16	21983920	missense	possibly damaging	0.60
R6734:Liph	UTSW	16	21983957	missense	probably damaging	0.97
R7011:Liph	UTSW	16	21984097	missense	probably damaging	0.98
R7038:Liph	UTSW	16	21976259	missense	probably damaging	1.00
R7178:Liph	UTSW	16	21976328	missense	probably damaging	1.00
R7185:Liph	UTSW	16	21995339	missense	probably benign	0.00
R7198:Liph	UTSW	16	21966022	missense	probably damaging	1.00
R7775:Liph	UTSW	16	21958914	missense	probably damaging	1.00
R7832:Liph	UTSW	16	21962236	missense	probably benign	0.01
R7993:Liph	UTSW	16	21958812	missense	probably benign	0.03
R8264:Liph	UTSW	16	21983971	missense	possibly damaging	0.94
R8551:Liph	UTSW	16	21981408	missense	probably damaging	1.00
R9311:Liph	UTSW	16	21956163	missense	probably damaging	1.00
R9311:Liph	UTSW	16	21983930	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCTGCTAAGCTGTAATGCCCTATCC -3'
(R):5'- GCATTCAGGAGGTGTGGTCAAACG -3'

Sequencing Primer
(F):5'- caacctaagctaaagagcaagac -3'
(R):5'- AGGTGTGGTCAAACGTGGTG -3'

Posted On

2013-07-30