Incidental Mutation 'R7950:Pten'
ID613034
Institutional Source Beutler Lab
Gene Symbol Pten
Ensembl Gene ENSMUSG00000013663
Gene Namephosphatase and tensin homolog
SynonymsA130070J02Rik, 2310035O07Rik, B430203M17Rik, MMAC1, TEP1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7950 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location32757497-32826160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32815494 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 238 (F238L)
Ref Sequence ENSEMBL: ENSMUSP00000013807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013807]
Predicted Effect probably benign
Transcript: ENSMUST00000013807
AA Change: F238L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013807
Gene: ENSMUSG00000013663
AA Change: F238L

DomainStartEndE-ValueType
Pfam:Y_phosphatase 42 183 2.7e-6 PFAM
Pfam:DSPc 67 173 2.4e-9 PFAM
PTEN_C2 188 349 4.07e-49 SMART
low complexity region 360 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a phosphatase with dual activity against phospholipids and proteins, and acts as a tumor-suppressor. The protein contains four structural domains, a PIP2-binding domain, a catalytic tensin-type phosphatase domain, a C2 tensin-type domain and a PDZ-binding domain. The protein belongs to the protein tyrosine phosphatase family. Deletion of this gene in mice contribute to tumorigenesis in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die by E9.5 with abnormally patterned enlarged brains and defective placentas. Heterozygotes develop a range of neoplasms. Conditional mutants demonstrate effects on basic processes of proliferation, differentiation and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,262,139 probably null Het
Abcf1 C A 17: 35,961,998 K252N probably damaging Het
Abi3 C T 11: 95,834,025 A211T possibly damaging Het
Acaca A T 11: 84,249,524 D608V possibly damaging Het
Akap10 A G 11: 61,900,446 Y396H probably damaging Het
Ap3b1 C G 13: 94,483,263 S778W unknown Het
Baat G A 4: 49,502,925 L66F probably benign Het
Cachd1 A G 4: 100,988,562 N981S probably damaging Het
Cacna1c C T 6: 118,776,446 R243H Het
Ccdc83 T C 7: 90,229,787 probably null Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cdkal1 T C 13: 29,474,412 probably null Het
Cinp A G 12: 110,874,123 V198A probably benign Het
Clec4d T C 6: 123,267,164 probably null Het
Cnn3 A G 3: 121,455,055 I204V probably benign Het
Cpxm2 C A 7: 132,049,071 G620V probably damaging Het
Ctrl A C 8: 105,932,865 S93A probably benign Het
Cyp2d34 A G 15: 82,617,224 V301A possibly damaging Het
D630045J12Rik T G 6: 38,181,310 probably null Het
Dnaaf5 G T 5: 139,161,810 K376N probably damaging Het
Eno2 C T 6: 124,763,174 D300N probably damaging Het
Fam117b T A 1: 59,974,887 N440K probably damaging Het
Fam131a A G 16: 20,695,834 S62G probably benign Het
Fam172a T C 13: 77,902,718 M165T probably benign Het
Fam189b T A 3: 89,185,776 Y280* probably null Het
Fancm T A 12: 65,116,466 probably null Het
Fancm A G 12: 65,118,399 D1506G probably benign Het
Fhad1 C A 4: 141,905,591 V1201L probably benign Het
Gdpd4 T A 7: 97,973,978 C265* probably null Het
Gm3127 A T 14: 4,166,115 T98S probably null Het
Gm4778 G C 3: 94,265,847 S50T probably benign Het
Gm9573 TCAGTGGTGGTCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG 17: 35,620,591 probably benign Het
Gpsm1 A T 2: 26,340,436 D466V probably benign Het
Gramd1a T G 7: 31,143,567 K76Q probably damaging Het
Gstp3 T C 19: 4,058,808 D24G probably damaging Het
Kalrn G A 16: 33,989,791 T2531I possibly damaging Het
Klk7 C A 7: 43,812,909 D108E probably damaging Het
Klkb1 A G 8: 45,286,965 S97P probably damaging Het
Krt13 T C 11: 100,121,182 D105G probably damaging Het
Krt78 AATGGTCACCTGGCCTCCAGATCCTCTCCCAGGCATGGTCACCTGGCCTCCAGATCCTCTCCCAGGCATGGTCACCTGGCCTCCA AATGGTCACCTGGCCTCCAGATCCTCTCCCAGGCATGGTCACCTGGCCTCCA 15: 101,947,803 probably benign Het
Lingo2 T A 4: 35,709,302 H226L probably benign Het
Lrba T C 3: 86,368,589 S1755P probably damaging Het
Marf1 A G 16: 14,128,606 V1217A probably damaging Het
Mtss1 A T 15: 58,971,009 V118E possibly damaging Het
Mug1 T A 6: 121,873,634 D696E probably benign Het
Ndufa3 C T 7: 3,620,004 P56L probably damaging Het
Nop56 T A 2: 130,278,285 C471S possibly damaging Het
Obscn T A 11: 59,000,826 H6960L unknown Het
Olfr535 C T 7: 140,493,136 T166I probably benign Het
Pcdhb10 A C 18: 37,413,566 Q565P probably benign Het
Pde6g T A 11: 120,448,127 H79L possibly damaging Het
Phrf1 G T 7: 141,256,611 M265I unknown Het
Pkd2 T C 5: 104,483,120 F470S probably damaging Het
Plekhm1 T A 11: 103,380,327 D446V probably damaging Het
Prkaca A T 8: 83,995,334 T325S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Ptpn21 G A 12: 98,705,176 L198F probably damaging Het
Rbm5 A T 9: 107,751,731 S394T probably benign Het
Rp1 T A 1: 4,351,873 probably null Het
Scaf8 T G 17: 3,177,719 S408A unknown Het
Slc41a3 T A 6: 90,640,927 F312I probably damaging Het
Soat2 T A 15: 102,151,163 probably null Het
Sorcs1 C A 19: 50,230,260 G595* probably null Het
Stox1 G T 10: 62,664,944 D612E probably benign Het
Suco T C 1: 161,837,796 I530M possibly damaging Het
Thbd G A 2: 148,407,744 A68V probably damaging Het
Tmem109 A T 19: 10,878,102 M4K unknown Het
Tmub1 G C 5: 24,446,666 P85R possibly damaging Het
Tnk2 A C 16: 32,681,235 Q1039H probably damaging Het
Tpm3 T C 3: 90,086,468 L89S probably damaging Het
Unc13b C T 4: 43,232,573 R432* probably null Het
Vmn2r59 T A 7: 42,012,283 I703F probably damaging Het
Xylt1 T A 7: 117,475,514 I122N probably benign Het
Zc3h12c T C 9: 52,143,948 E187G probably damaging Het
Other mutations in Pten
AlleleSourceChrCoordTypePredicted EffectPPH Score
Brakes UTSW 19 32815497 missense probably benign
Bremse UTSW 19 32800085 missense possibly damaging 0.91
R0131:Pten UTSW 19 32776069 missense probably benign 0.15
R0557:Pten UTSW 19 32817890 missense probably benign
R1387:Pten UTSW 19 32798096 missense probably benign
R1479:Pten UTSW 19 32819850 missense probably damaging 0.99
R1773:Pten UTSW 19 32798072 missense probably damaging 1.00
R4801:Pten UTSW 19 32758503 missense possibly damaging 0.75
R4802:Pten UTSW 19 32758503 missense possibly damaging 0.75
R5196:Pten UTSW 19 32815497 missense probably benign
R5200:Pten UTSW 19 32799891 missense probably damaging 0.97
R5672:Pten UTSW 19 32758466 missense probably benign
R6143:Pten UTSW 19 32800085 missense possibly damaging 0.91
R7644:Pten UTSW 19 32811834 missense probably damaging 1.00
R7849:Pten UTSW 19 32799996 missense probably damaging 1.00
R7867:Pten UTSW 19 32815494 missense probably benign
R7932:Pten UTSW 19 32799996 missense probably damaging 1.00
Z1088:Pten UTSW 19 32776051 missense probably damaging 0.96
Z1088:Pten UTSW 19 32799998 missense probably damaging 1.00
Z1176:Pten UTSW 19 32798115 critical splice donor site probably null
Z1177:Pten UTSW 19 32811805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAAGTCCTTACATGGGTTGG -3'
(R):5'- ATCAGTTTGGTAGATGGCAGAG -3'

Sequencing Primer
(F):5'- AGAAGTCCTTACATGGGTTGGTTATG -3'
(R):5'- TTTGGTAGATGGCAGAGAAATAGTC -3'
Posted On2019-12-27