Incidental Mutation 'R7951:Peak1'
ID613072
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R7951 (G1)
Quality Score218.009
Status Not validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56260470 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 58 (T58K)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]
Predicted Effect probably damaging
Transcript: ENSMUST00000061552
AA Change: T58K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: T58K

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186735
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
Acacb A G 5: 114,248,227 E2274G probably benign Het
Adam7 A G 14: 68,532,641 I21T possibly damaging Het
Aldh3b3 C T 19: 3,968,492 R57* probably null Het
Arhgap22 T C 14: 33,364,516 probably benign Het
B4galt5 G T 2: 167,301,420 Y361* probably null Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bsn G T 9: 108,114,899 A1218D possibly damaging Het
Ccdc141 T C 2: 77,108,412 D283G probably damaging Het
Ccdc33 T A 9: 58,069,091 I547F probably benign Het
Chdh A G 14: 30,031,331 N66D probably benign Het
Ckap2l T A 2: 129,285,289 Q323L probably damaging Het
Cpvl T A 6: 53,974,760 I13F possibly damaging Het
Creb3l2 G A 6: 37,335,869 P410L probably damaging Het
Dna2 T C 10: 62,969,864 V960A probably benign Het
Dopey1 G A 9: 86,501,984 probably null Het
Dpysl5 A T 5: 30,745,416 D64V probably damaging Het
Dysf A G 6: 84,114,099 Q1041R probably benign Het
Efcab7 T C 4: 99,888,957 V242A probably benign Het
Ehbp1 G A 11: 22,146,542 R341* probably null Het
Fbxo32 A T 15: 58,214,590 W8R probably damaging Het
Fpgs T C 2: 32,683,460 N455D probably damaging Het
Fsip1 G A 2: 118,136,486 Q453* probably null Het
Gm10220 C T 5: 26,118,755 probably null Het
Gm13103 A G 4: 143,851,584 H138R possibly damaging Het
Gm8257 T A 14: 44,657,297 E12V probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm9573 TGCTGGATGCAGTGGTGGTCGGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTC TGCTGGATGCAGTGGTGGTC 17: 35,620,493 probably benign Het
Itih2 C T 2: 10,126,146 probably null Het
Kdm3a A T 6: 71,595,489 D1029E probably benign Het
Lipo4 T G 19: 33,511,568 Q205P possibly damaging Het
Lpar6 A T 14: 73,238,995 N132I probably damaging Het
Lrp1b C T 2: 41,449,234 G866S Het
Man2c1 T C 9: 57,137,986 F460L probably damaging Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Map4k1 A T 7: 28,999,962 probably null Het
Matn1 A G 4: 130,955,000 E496G probably damaging Het
Mfsd2a A T 4: 122,956,855 V76E possibly damaging Het
Mtpap A G 18: 4,380,673 E117G probably damaging Het
Muc3 T A 5: 137,146,777 N15I Het
Mut C T 17: 40,947,043 R367C probably damaging Het
Ndufa10 A G 1: 92,460,447 Y275H probably damaging Het
Nlrc4 A T 17: 74,448,052 H56Q possibly damaging Het
Nrde2 G A 12: 100,131,187 R785C possibly damaging Het
Nsun4 C A 4: 116,034,132 C350F probably benign Het
Olfr1410 G A 1: 92,608,515 G226D possibly damaging Het
Olfr229 T A 9: 39,909,986 F61Y probably benign Het
Olfr417 A G 1: 174,368,985 T23A probably benign Het
Olfr560 A G 7: 102,753,605 L108P possibly damaging Het
Pdcd7 T A 9: 65,346,979 C280S probably damaging Het
Phactr2 T C 10: 13,232,609 E573G probably damaging Het
Ptprz1 G A 6: 23,000,964 A1018T not run Het
Ralgapa1 G T 12: 55,612,638 D2032E probably benign Het
Rapgef4 T A 2: 72,201,137 N488K probably benign Het
Slc1a2 A G 2: 102,761,185 D420G probably benign Het
Smyd5 T A 6: 85,444,315 L337Q probably damaging Het
Tenm4 G A 7: 96,906,380 R2764H possibly damaging Het
Tex35 A T 1: 157,099,338 Y195* probably null Het
Tln2 T C 9: 67,348,226 K690E probably damaging Het
Trpc4 A G 3: 54,302,286 T691A probably benign Het
Tsr1 T A 11: 74,900,332 F246I possibly damaging Het
Ubr4 A T 4: 139,460,033 Y669F unknown Het
Uox A C 3: 146,610,274 D12A probably benign Het
Wdr17 A G 8: 54,696,267 probably null Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R0865:Peak1 UTSW 9 56257832 missense probably benign 0.02
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3832:Peak1 UTSW 9 56258383 missense probably benign
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R3964:Peak1 UTSW 9 56259979 missense probably damaging 1.00
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56260289 missense probably damaging 1.00
R5435:Peak1 UTSW 9 56206486 missense probably damaging 0.98
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6347:Peak1 UTSW 9 56258211 missense probably benign 0.00
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
R7604:Peak1 UTSW 9 56241207 nonsense probably null
R7868:Peak1 UTSW 9 56260470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCAGCATCACCTTCAG -3'
(R):5'- GCACTGAAGGAAAAGCATTGTC -3'

Sequencing Primer
(F):5'- CAGCATCACCTTCAGAATTGTTG -3'
(R):5'- CTGAACACGTTTGGAAACC -3'
Posted On2019-12-27