Mutagenetix > Incidental Mutations

Incidental Mutation 'R0690:Gli2'

61308

Institutional Source

Beutler Lab

Gene Symbol

Gli2

Ensembl Gene

ENSMUSG00000048402

Gene Name

GLI-Kruppel family member GLI2

Synonyms

MMRRC Submission

038875-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0690 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

118834132-119053619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118844460 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 505 (R505L)

Ref Sequence

ENSEMBL: ENSMUSP00000054837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062483] [ENSMUST00000159839] [ENSMUST00000160991] [ENSMUST00000161056] [ENSMUST00000161301] [ENSMUST00000161451] [ENSMUST00000162552] [ENSMUST00000162607]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062483
AA Change: R505L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: R505L

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	259	278	N/A	INTRINSIC
ZnF_C2H2	417	442	4.98e-1	SMART
ZnF_C2H2	450	477	6.57e0	SMART
ZnF_C2H2	483	507	2.09e-3	SMART
ZnF_C2H2	513	538	4.17e-3	SMART
ZnF_C2H2	544	569	1.84e-4	SMART
low complexity region	637	657	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC
low complexity region	930	945	N/A	INTRINSIC
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1428	1435	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159839

SMART Domains

Protein: ENSMUSP00000125661
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160991

Predicted Effect

probably benign
Transcript: ENSMUST00000161056

SMART Domains

Protein: ENSMUSP00000124768
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161301

SMART Domains

Protein: ENSMUSP00000125342
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	58	72	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161451

SMART Domains

Protein: ENSMUSP00000124132
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162552

SMART Domains

Protein: ENSMUSP00000125059
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162607

SMART Domains

Protein: ENSMUSP00000123808
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	120	139	N/A	INTRINSIC

Meta Mutation Damage Score

0.7245

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (87/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,969,808		probably benign	Het
Abi3	T	C	11: 95,833,634		probably benign	Het
Adam2	T	C	14: 66,057,646	N250S	probably damaging	Het
Agbl4	T	A	4: 111,657,388	I532K	probably benign	Het
Agrn	T	G	4: 156,174,453	E905A	probably damaging	Het
Ahi1	A	G	10: 20,970,843		probably benign	Het
Aifm2	A	G	10: 61,726,452	N89S	probably benign	Het
Arsj	C	T	3: 126,438,184	T193I	probably damaging	Het
Ascc2	T	A	11: 4,682,933	V702E	probably damaging	Het
Avpr1b	T	C	1: 131,600,281	S181P	probably damaging	Het
Bcl7a	G	A	5: 123,351,940	V56I	possibly damaging	Het
Cd160	T	A	3: 96,805,786	D54V	probably damaging	Het
Celsr2	C	A	3: 108,414,977	R173M	probably damaging	Het
Cfap57	A	G	4: 118,569,727		probably benign	Het
Cfap69	G	A	5: 5,663,951	T27I	probably damaging	Het
Chaf1b	T	C	16: 93,900,017		probably benign	Het
Cldn8	C	T	16: 88,562,639	V133M	probably damaging	Het
Col2a1	A	T	15: 97,980,192	V954E	unknown	Het
Col6a4	T	C	9: 106,028,187		probably benign	Het
Col6a6	T	C	9: 105,709,486	M1779V	probably benign	Het
Coq8b	A	G	7: 27,242,249	E253G	probably benign	Het
Ctse	T	C	1: 131,674,778		probably benign	Het
Cyp2c29	T	A	19: 39,309,726	N238K	probably benign	Het
Dcaf1	T	A	9: 106,846,649		probably benign	Het
Dcc	A	T	18: 71,809,204		probably benign	Het
Dkk1	A	G	19: 30,549,345	F12S	probably benign	Het
Dnah6	A	G	6: 73,129,474	V1760A	probably benign	Het
Fam117b	G	A	1: 59,958,353	S288N	possibly damaging	Het
Fam216a	A	T	5: 122,367,646	M110K	probably damaging	Het
Frem3	T	A	8: 80,613,952	I958N	possibly damaging	Het
Gab1	T	A	8: 80,800,116	N118Y	probably damaging	Het
Gda	T	A	19: 21,409,887	I251L	probably benign	Het
Gm5093	A	T	17: 46,439,738	I121N	possibly damaging	Het
Gpnmb	C	T	6: 49,048,015	S327L	probably benign	Het
Gpr156	T	A	16: 37,992,141	Y280N	probably damaging	Het
Gria4	A	G	9: 4,427,071	Y790H	probably damaging	Het
Guf1	C	A	5: 69,566,352		probably null	Het
H6pd	T	C	4: 149,982,573	E452G	possibly damaging	Het
Herc1	T	A	9: 66,386,838	Y487*	probably null	Het
Ifi30	T	A	8: 70,764,949		probably benign	Het
Klf13	G	A	7: 63,938,071	A159V	possibly damaging	Het
Med11	T	A	11: 70,453,226	M124K	possibly damaging	Het
Myom3	A	G	4: 135,788,426		probably benign	Het
Nat2	A	T	8: 67,501,804	I189F	probably damaging	Het
Nhlrc4	C	G	17: 25,943,684	G30R	probably damaging	Het
Nkx3-2	G	A	5: 41,762,127	R173C	probably damaging	Het
Nox3	T	C	17: 3,695,564	N23S	probably damaging	Het
Npr2	A	T	4: 43,646,991	Y708F	probably damaging	Het
Nsun2	A	G	13: 69,629,542	N409S	probably benign	Het
Nucb2	T	C	7: 116,535,851		probably benign	Het
Olfr1105	A	G	2: 87,033,882	F113S	probably damaging	Het
Olfr541	T	C	7: 140,704,787	F179L	possibly damaging	Het
Olfr874	T	C	9: 37,746,217	F28L	probably benign	Het
Orai2	A	T	5: 136,161,599	V52D	probably damaging	Het
Pcyox1	A	T	6: 86,394,442	M154K	probably damaging	Het
Pik3r4	C	A	9: 105,653,976	T492K	possibly damaging	Het
Pmpca	T	A	2: 26,391,097	Y150N	probably damaging	Het
Ppp1r12b	G	T	1: 134,876,082	S446R	probably damaging	Het
Ptpdc1	A	G	13: 48,586,905	I289T	probably benign	Het
Pyroxd2	A	G	19: 42,727,642		probably benign	Het
Qrfpr	G	A	3: 36,189,559	T131M	probably damaging	Het
Rab33b	A	G	3: 51,493,417	Y104C	probably damaging	Het
Rad54l	G	T	4: 116,099,750		probably benign	Het
Rad9a	A	T	19: 4,197,360		probably null	Het
Slc1a5	A	T	7: 16,786,904	M233L	probably benign	Het
Slc47a2	C	T	11: 61,342,504	V67I	possibly damaging	Het
Slco1a5	T	A	6: 142,268,278	Y39F	probably benign	Het
Slfn5	T	C	11: 82,961,403	V785A	probably damaging	Het
Sp6	C	T	11: 97,021,544	P28S	possibly damaging	Het
Sptbn5	A	G	2: 120,062,675		probably null	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
St8sia1	A	G	6: 142,829,254	W200R	probably damaging	Het
Stxbp1	C	A	2: 32,800,695		probably benign	Het
Syne1	A	G	10: 5,033,138		probably benign	Het
Thbs3	T	A	3: 89,220,165	I371N	possibly damaging	Het
Tll1	C	T	8: 64,074,290	S399N	probably damaging	Het
Tmem209	A	C	6: 30,505,834	C114G	probably null	Het
Tmem25	C	T	9: 44,795,514		probably benign	Het
Tmem8b	T	C	4: 43,674,562	I282T	possibly damaging	Het
Trdmt1	T	A	2: 13,544,580	H18L	probably benign	Het
Trim63	A	G	4: 134,316,405	T60A	probably benign	Het
Trpv2	T	C	11: 62,584,676		probably null	Het
Ubr2	A	T	17: 46,938,653	I1591K	probably damaging	Het
Use1	A	T	8: 71,367,065		probably benign	Het
Zfp850	A	T	7: 27,985,217	C35S	possibly damaging	Het

Other mutations in Gli2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Gli2	APN	1	118836891	missense	probably benign
IGL01686:Gli2	APN	1	118848435	missense	probably damaging	1.00
IGL01925:Gli2	APN	1	118853376	missense	probably damaging	1.00
IGL02106:Gli2	APN	1	118836735	missense	probably benign
IGL02202:Gli2	APN	1	118836866	missense	probably damaging	0.96
IGL02255:Gli2	APN	1	118844349	critical splice donor site	probably null
IGL02437:Gli2	APN	1	118836003	missense	probably damaging	1.00
IGL02615:Gli2	APN	1	118844398	missense	probably damaging	1.00
IGL02817:Gli2	APN	1	118836371	missense	possibly damaging	0.55
IGL03294:Gli2	APN	1	118837436	missense	probably benign
fairyfly	UTSW	1	118840490	missense	possibly damaging	0.93
flea	UTSW	1	118835925	missense	probably damaging	0.99
patu_digua	UTSW	1	118837506	missense	probably damaging	1.00
BB006:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
BB016:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
R0055:Gli2	UTSW	1	118890408	intron	probably benign
R0055:Gli2	UTSW	1	118890408	intron	probably benign
R0164:Gli2	UTSW	1	118890283	intron	probably benign
R0233:Gli2	UTSW	1	118835925	missense	probably damaging	0.99
R0233:Gli2	UTSW	1	118835925	missense	probably damaging	0.99
R0308:Gli2	UTSW	1	118842062	missense	probably benign	0.00
R0418:Gli2	UTSW	1	118840490	missense	possibly damaging	0.93
R0558:Gli2	UTSW	1	118837649	missense	probably benign	0.01
R0600:Gli2	UTSW	1	118840389	missense	probably damaging	1.00
R0630:Gli2	UTSW	1	118841918	missense	possibly damaging	0.52
R0942:Gli2	UTSW	1	118837506	missense	probably damaging	1.00
R1061:Gli2	UTSW	1	118854517	missense	possibly damaging	0.71
R1104:Gli2	UTSW	1	118853350	missense	probably damaging	1.00
R1141:Gli2	UTSW	1	118837937	missense	possibly damaging	0.71
R1344:Gli2	UTSW	1	118841936	missense	probably damaging	0.98
R1418:Gli2	UTSW	1	118841936	missense	probably damaging	0.98
R1565:Gli2	UTSW	1	118841930	missense	possibly damaging	0.57
R1605:Gli2	UTSW	1	118854560	missense	probably damaging	1.00
R1640:Gli2	UTSW	1	118836524	missense	possibly damaging	0.83
R1728:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1728:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1729:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1729:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1730:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1730:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1739:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1739:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1762:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1762:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1783:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1783:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1785:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1785:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1874:Gli2	UTSW	1	119002049	missense	possibly damaging	0.83
R1969:Gli2	UTSW	1	118837700	missense	probably benign	0.00
R2199:Gli2	UTSW	1	118837648	missense	possibly damaging	0.95
R2377:Gli2	UTSW	1	118837125	missense	possibly damaging	0.90
R2883:Gli2	UTSW	1	118868144	missense	probably damaging	0.97
R2924:Gli2	UTSW	1	118836359	missense	probably benign	0.00
R4363:Gli2	UTSW	1	118853370	missense	probably benign	0.00
R4430:Gli2	UTSW	1	118837244	missense	probably benign
R4463:Gli2	UTSW	1	118836008	missense	probably damaging	1.00
R4583:Gli2	UTSW	1	118842068	missense	probably benign
R4613:Gli2	UTSW	1	118837511	missense	probably damaging	1.00
R4674:Gli2	UTSW	1	118836029	missense	probably damaging	1.00
R4735:Gli2	UTSW	1	118840322	missense	probably damaging	1.00
R4770:Gli2	UTSW	1	118982588	intron	probably benign
R4936:Gli2	UTSW	1	118836140	missense	probably benign
R5137:Gli2	UTSW	1	118855503	missense	probably damaging	1.00
R5228:Gli2	UTSW	1	118836206	missense	probably damaging	1.00
R5318:Gli2	UTSW	1	118844470	missense	probably damaging	1.00
R5619:Gli2	UTSW	1	118836755	missense	probably benign	0.27
R5661:Gli2	UTSW	1	118853302	nonsense	probably null
R6005:Gli2	UTSW	1	118842064	missense	probably damaging	1.00
R6012:Gli2	UTSW	1	118837715	missense	probably damaging	0.99
R6341:Gli2	UTSW	1	118836224	missense	probably damaging	1.00
R6357:Gli2	UTSW	1	118841959	missense	probably damaging	1.00
R6425:Gli2	UTSW	1	118835894	nonsense	probably null
R6513:Gli2	UTSW	1	118855554	missense	probably damaging	1.00
R6802:Gli2	UTSW	1	118842065	missense	probably damaging	1.00
R6889:Gli2	UTSW	1	118844416	missense	probably damaging	1.00
R7259:Gli2	UTSW	1	118836534	missense	probably benign
R7378:Gli2	UTSW	1	118848492	missense	probably damaging	1.00
R7420:Gli2	UTSW	1	118835939	missense	probably benign	0.00
R7489:Gli2	UTSW	1	118838175	missense	probably benign	0.00
R7498:Gli2	UTSW	1	118835835	missense	possibly damaging	0.89
R7929:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
R8032:Gli2	UTSW	1	118836170	missense	probably damaging	0.98
R8150:Gli2	UTSW	1	118835828	missense	probably damaging	0.99
R8233:Gli2	UTSW	1	118844437	missense	probably damaging	1.00
R8282:Gli2	UTSW	1	118837971	missense	probably damaging	1.00
R8312:Gli2	UTSW	1	118868112	intron	probably benign
X0028:Gli2	UTSW	1	118837277	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTATACATGCCAGGGCCTCTGC -3'
(R):5'- TGCACGCTCCTGTATTTCACAGTAAAG -3'

Sequencing Primer
(F):5'- TTCTGCATATCGCAGCCA -3'
(R):5'- GTATTTCACAGTAAAGCTCTCCCAC -3'

Posted On

2013-07-30