Incidental Mutation 'R7951:Adam7'
ID613091
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7951 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68532641 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 21 (I21T)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022640
AA Change: I21T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: I21T

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,587,410 probably null Het
Acacb A G 5: 114,248,227 E2274G probably benign Het
Aldh3b3 C T 19: 3,968,492 R57* probably null Het
Arhgap22 T C 14: 33,364,516 probably benign Het
B4galt5 G T 2: 167,301,420 Y361* probably null Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bsn G T 9: 108,114,899 A1218D possibly damaging Het
Ccdc141 T C 2: 77,108,412 D283G probably damaging Het
Ccdc33 T A 9: 58,069,091 I547F probably benign Het
Chdh A G 14: 30,031,331 N66D probably benign Het
Ckap2l T A 2: 129,285,289 Q323L probably damaging Het
Cpvl T A 6: 53,974,760 I13F possibly damaging Het
Creb3l2 G A 6: 37,335,869 P410L probably damaging Het
Dna2 T C 10: 62,969,864 V960A probably benign Het
Dopey1 G A 9: 86,501,984 probably null Het
Dpysl5 A T 5: 30,745,416 D64V probably damaging Het
Dysf A G 6: 84,114,099 Q1041R probably benign Het
Efcab7 T C 4: 99,888,957 V242A probably benign Het
Ehbp1 G A 11: 22,146,542 R341* probably null Het
Fbxo32 A T 15: 58,214,590 W8R probably damaging Het
Fpgs T C 2: 32,683,460 N455D probably damaging Het
Fsip1 G A 2: 118,136,486 Q453* probably null Het
Gm10220 C T 5: 26,118,755 probably null Het
Gm13103 A G 4: 143,851,584 H138R possibly damaging Het
Gm8257 T A 14: 44,657,297 E12V probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm9573 TGCTGGATGCAGTGGTGGTCGGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTC TGCTGGATGCAGTGGTGGTC 17: 35,620,493 probably benign Het
Itih2 C T 2: 10,126,146 probably null Het
Kdm3a A T 6: 71,595,489 D1029E probably benign Het
Lipo4 T G 19: 33,511,568 Q205P possibly damaging Het
Lpar6 A T 14: 73,238,995 N132I probably damaging Het
Lrp1b C T 2: 41,449,234 G866S Het
Man2c1 T C 9: 57,137,986 F460L probably damaging Het
Map3k7cl T C 16: 87,581,212 V72A probably damaging Het
Map4k1 A T 7: 28,999,962 probably null Het
Matn1 A G 4: 130,955,000 E496G probably damaging Het
Mfsd2a A T 4: 122,956,855 V76E possibly damaging Het
Mtpap A G 18: 4,380,673 E117G probably damaging Het
Muc3 T A 5: 137,146,777 N15I Het
Mut C T 17: 40,947,043 R367C probably damaging Het
Ndufa10 A G 1: 92,460,447 Y275H probably damaging Het
Nlrc4 A T 17: 74,448,052 H56Q possibly damaging Het
Nrde2 G A 12: 100,131,187 R785C possibly damaging Het
Nsun4 C A 4: 116,034,132 C350F probably benign Het
Olfr1410 G A 1: 92,608,515 G226D possibly damaging Het
Olfr229 T A 9: 39,909,986 F61Y probably benign Het
Olfr417 A G 1: 174,368,985 T23A probably benign Het
Olfr560 A G 7: 102,753,605 L108P possibly damaging Het
Pdcd7 T A 9: 65,346,979 C280S probably damaging Het
Peak1 G T 9: 56,260,470 T58K probably damaging Het
Phactr2 T C 10: 13,232,609 E573G probably damaging Het
Ptprz1 G A 6: 23,000,964 A1018T not run Het
Ralgapa1 G T 12: 55,612,638 D2032E probably benign Het
Rapgef4 T A 2: 72,201,137 N488K probably benign Het
Slc1a2 A G 2: 102,761,185 D420G probably benign Het
Smyd5 T A 6: 85,444,315 L337Q probably damaging Het
Tenm4 G A 7: 96,906,380 R2764H possibly damaging Het
Tex35 A T 1: 157,099,338 Y195* probably null Het
Tln2 T C 9: 67,348,226 K690E probably damaging Het
Trpc4 A G 3: 54,302,286 T691A probably benign Het
Tsr1 T A 11: 74,900,332 F246I possibly damaging Het
Ubr4 A T 4: 139,460,033 Y669F unknown Het
Uox A C 3: 146,610,274 D12A probably benign Het
Wdr17 A G 8: 54,696,267 probably null Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 intron probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCATACACTGTAAACCAAGTGGG -3'
(R):5'- TCTGTAAATAGCCATCTCAACTTCC -3'

Sequencing Primer
(F):5'- CTGAAAACCACATTTGCTTCATAG -3'
(R):5'- TCCTCACATCGCTAGCTAAGG -3'
Posted On2019-12-27