Incidental Mutation 'R7952:Alkbh8'
ID613135
Institutional Source Beutler Lab
Gene Symbol Alkbh8
Ensembl Gene ENSMUSG00000025899
Gene NamealkB homolog 8, tRNA methyltransferase
Synonyms4930562C03Rik, Abh8, 9430088N01Rik, 8030431D03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7952 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location3335140-3391154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3359503 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 264 (H264L)
Ref Sequence ENSEMBL: ENSMUSP00000061511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053407] [ENSMUST00000165105] [ENSMUST00000211933] [ENSMUST00000212294] [ENSMUST00000212358] [ENSMUST00000212817]
Predicted Effect probably damaging
Transcript: ENSMUST00000053407
AA Change: H264L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061511
Gene: ENSMUSG00000025899
AA Change: H264L

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 8.7e-27 PFAM
Pfam:2OG-FeII_Oxy 220 336 1.8e-11 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_23 386 534 1e-9 PFAM
Pfam:Methyltransf_31 404 547 3.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.7e-9 PFAM
Pfam:Methyltransf_11 411 501 5.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165105
AA Change: H264L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125996
Gene: ENSMUSG00000025899
AA Change: H264L

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 1.6e-24 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.5e-9 PFAM
Pfam:Methyltransf_11 411 501 1.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211933
AA Change: H264L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212294
AA Change: H229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212358
Predicted Effect probably benign
Transcript: ENSMUST00000212817
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants show no obvious phenotype at 20 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,184,135 R738C possibly damaging Het
Acot12 G A 13: 91,771,725 V260M probably benign Het
Arfgef2 C T 2: 166,873,703 T1356I probably damaging Het
Arhgap27 A T 11: 103,360,304 N199K probably damaging Het
Asic2 T C 11: 81,967,998 R63G probably damaging Het
Aspa T A 11: 73,313,552 M197L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Brdt A T 5: 107,370,179 I723L probably benign Het
C2cd3 T A 7: 100,469,491 F2312Y probably damaging Het
Cacng5 C T 11: 107,881,592 probably null Het
Cd19 T C 7: 126,410,526 N456S probably damaging Het
Ceacam1 G T 7: 25,476,529 A80E probably damaging Het
Cep135 T C 5: 76,640,956 V1132A probably benign Het
Cep85 A G 4: 134,132,298 C687R probably damaging Het
Cln5 A G 14: 103,076,065 Y251C probably damaging Het
Crygc A G 1: 65,071,855 M91T possibly damaging Het
Ddt T C 10: 75,773,226 K33R probably damaging Het
Dhfr G A 13: 92,357,963 W58* probably null Het
Dhx40 T C 11: 86,797,706 E297G probably benign Het
Dner T C 1: 84,383,881 Y669C probably benign Het
Dpys G T 15: 39,793,386 F428L probably damaging Het
Dspp A C 5: 104,175,665 T225P probably damaging Het
Elac2 A G 11: 64,999,387 K656E probably damaging Het
Ern1 T A 11: 106,459,019 R24* probably null Het
F2rl2 T C 13: 95,701,011 I188T probably damaging Het
Fam83b C T 9: 76,492,144 C559Y possibly damaging Het
Fat1 T G 8: 45,051,222 F4584C probably benign Het
Gabra6 G A 11: 42,316,495 T254I possibly damaging Het
Garem1 T C 18: 21,299,700 D24G probably damaging Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gpr68 C T 12: 100,879,238 D16N probably benign Het
Il17b T C 18: 61,692,409 I172T probably damaging Het
Ildr2 T G 1: 166,309,292 S567A probably benign Het
Kalrn A G 16: 33,988,847 V2557A probably damaging Het
Kif1b A G 4: 149,184,376 S1627P probably benign Het
Kif5a G A 10: 127,243,474 T285M probably damaging Het
Lrif1 G A 3: 106,733,143 probably null Het
Lrrn2 C T 1: 132,939,378 T727I unknown Het
Lsg1 T C 16: 30,564,722 E560G probably benign Het
Map4k4 C A 1: 39,974,044 Q100K unknown Het
Mipep A T 14: 60,802,936 R302W probably damaging Het
Morf4l1 G T 9: 90,093,791 T316K probably damaging Het
Mov10 A T 3: 104,804,678 V126E probably damaging Het
Muc2 T A 7: 141,749,734 C559S Het
Myh7 A G 14: 54,989,073 Y410H probably damaging Het
Nf1 T A 11: 79,418,588 Y433N probably damaging Het
Nmd3 T C 3: 69,726,417 L79P probably damaging Het
Nol10 G T 12: 17,358,238 S155I probably null Het
Olfr1208 T C 2: 88,897,064 I178V probably benign Het
Olfr134 T C 17: 38,175,939 L285P possibly damaging Het
Olfr1448 A G 19: 12,919,547 I254T probably benign Het
Olfr668 T A 7: 104,925,104 Y220F probably damaging Het
Pde3b T C 7: 114,494,687 S389P probably benign Het
Polr1c C T 17: 46,244,891 G188D probably benign Het
Polrmt C T 10: 79,741,983 probably null Het
Prpf31 A G 7: 3,630,860 M65V probably benign Het
Pum2 A G 12: 8,713,595 T251A probably benign Het
Rabgap1 G A 2: 37,487,130 V325I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl15 G T 14: 18,269,017 Y203* probably null Het
Sac3d1 G A 19: 6,118,426 P54L possibly damaging Het
Serpina3g A G 12: 104,240,251 I104V probably benign Het
Setd2 C T 9: 110,550,014 Q966* probably null Het
Simc1 G T 13: 54,503,900 D9Y unknown Het
Slc5a8 T C 10: 88,921,705 L519S probably benign Het
Srcap C A 7: 127,539,194 Q1179K possibly damaging Het
Srd5a3 T C 5: 76,147,736 L91P probably damaging Het
Stab1 T C 14: 31,154,472 T887A probably benign Het
Sult2a6 A G 7: 14,254,812 F8L not run Het
Thsd7a A T 6: 12,471,124 C498* probably null Het
Timp4 T C 6: 115,250,394 I75V probably benign Het
Tspyl4 T A 10: 34,298,100 M196K probably damaging Het
Ubr2 T C 17: 46,991,008 E172G probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13c T G 9: 73,694,877 L1362F probably damaging Het
Unc13d A T 11: 116,064,941 probably null Het
Vmn2r11 A G 5: 109,052,120 V489A probably damaging Het
Vps39 T C 2: 120,339,394 T226A possibly damaging Het
Zan C T 5: 137,473,601 E185K probably damaging Het
Other mutations in Alkbh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Alkbh8 APN 9 3359588 missense probably damaging 1.00
IGL01419:Alkbh8 APN 9 3385354 missense probably damaging 1.00
IGL01457:Alkbh8 APN 9 3369825 missense probably damaging 1.00
IGL02398:Alkbh8 APN 9 3345870 missense possibly damaging 0.77
IGL02503:Alkbh8 APN 9 3347852 missense probably damaging 1.00
IGL02824:Alkbh8 APN 9 3368021 splice site probably null
IGL03001:Alkbh8 APN 9 3344602 missense probably benign
IGL03055:Alkbh8 APN 9 3345882 splice site probably benign
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0403:Alkbh8 UTSW 9 3385469 missense probably damaging 1.00
R1331:Alkbh8 UTSW 9 3347916 unclassified probably null
R1688:Alkbh8 UTSW 9 3382765 missense probably damaging 1.00
R1859:Alkbh8 UTSW 9 3385499 missense probably benign 0.07
R2014:Alkbh8 UTSW 9 3343216 nonsense probably null
R3016:Alkbh8 UTSW 9 3369658 missense probably benign 0.08
R3722:Alkbh8 UTSW 9 3385153 missense probably damaging 1.00
R4744:Alkbh8 UTSW 9 3344604 nonsense probably null
R4840:Alkbh8 UTSW 9 3369751 missense probably damaging 1.00
R5403:Alkbh8 UTSW 9 3385318 missense probably benign 0.00
R5644:Alkbh8 UTSW 9 3385384 missense probably damaging 1.00
R5677:Alkbh8 UTSW 9 3385147 missense possibly damaging 0.93
R5902:Alkbh8 UTSW 9 3385414 missense probably benign 0.04
R6293:Alkbh8 UTSW 9 3347841 missense possibly damaging 0.52
R7352:Alkbh8 UTSW 9 3345796 missense probably damaging 0.99
R7457:Alkbh8 UTSW 9 3343056 missense probably damaging 0.99
R7869:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R7887:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R7970:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R8052:Alkbh8 UTSW 9 3385478 missense probably damaging 1.00
X0028:Alkbh8 UTSW 9 3369767 missense probably benign 0.01
X0062:Alkbh8 UTSW 9 3359532 missense probably null 1.00
Z1176:Alkbh8 UTSW 9 3345820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCTTTAGCGTTTCTGATG -3'
(R):5'- ACAGGACATGGCTTCAGCAG -3'

Sequencing Primer
(F):5'- TTTGAACTCAGGACCTTCGGAAG -3'
(R):5'- GCTTCAGCAGCTCAGATAGTAAAC -3'
Posted On2019-12-27