Mutagenetix > Incidental Mutations

Incidental Mutation 'R0690:Stxbp1'

61314

Institutional Source

Beutler Lab

Gene Symbol

Stxbp1

Ensembl Gene

ENSMUSG00000026797

Gene Name

syntaxin binding protein 1

Synonyms

Rb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1

MMRRC Submission

038875-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.665) question?

Stock #

R0690 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

32787602-32847245 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 32800695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000089051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458]

AlphaFold

O08599

Predicted Effect

probably benign
Transcript: ENSMUST00000050000

SMART Domains

Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797

Domain	Start	End	E-Value	Type
Pfam:Sec1	28	582	9.8e-152	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000077458

SMART Domains

Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797

Domain	Start	End	E-Value	Type
Pfam:Sec1	29	581	2.8e-110	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000113222

SMART Domains

Protein: ENSMUSP00000108848
Gene: ENSMUSG00000026797

Domain	Start	End	E-Value	Type
Pfam:Sec1	1	419	1.7e-106	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (87/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,969,808		probably benign	Het
Abi3	T	C	11: 95,833,634		probably benign	Het
Adam2	T	C	14: 66,057,646	N250S	probably damaging	Het
Agbl4	T	A	4: 111,657,388	I532K	probably benign	Het
Agrn	T	G	4: 156,174,453	E905A	probably damaging	Het
Ahi1	A	G	10: 20,970,843		probably benign	Het
Aifm2	A	G	10: 61,726,452	N89S	probably benign	Het
Arsj	C	T	3: 126,438,184	T193I	probably damaging	Het
Ascc2	T	A	11: 4,682,933	V702E	probably damaging	Het
Avpr1b	T	C	1: 131,600,281	S181P	probably damaging	Het
Bcl7a	G	A	5: 123,351,940	V56I	possibly damaging	Het
Cd160	T	A	3: 96,805,786	D54V	probably damaging	Het
Celsr2	C	A	3: 108,414,977	R173M	probably damaging	Het
Cfap57	A	G	4: 118,569,727		probably benign	Het
Cfap69	G	A	5: 5,663,951	T27I	probably damaging	Het
Chaf1b	T	C	16: 93,900,017		probably benign	Het
Cldn8	C	T	16: 88,562,639	V133M	probably damaging	Het
Col2a1	A	T	15: 97,980,192	V954E	unknown	Het
Col6a4	T	C	9: 106,028,187		probably benign	Het
Col6a6	T	C	9: 105,709,486	M1779V	probably benign	Het
Coq8b	A	G	7: 27,242,249	E253G	probably benign	Het
Ctse	T	C	1: 131,674,778		probably benign	Het
Cyp2c29	T	A	19: 39,309,726	N238K	probably benign	Het
Dcaf1	T	A	9: 106,846,649		probably benign	Het
Dcc	A	T	18: 71,809,204		probably benign	Het
Dkk1	A	G	19: 30,549,345	F12S	probably benign	Het
Dnah6	A	G	6: 73,129,474	V1760A	probably benign	Het
Fam117b	G	A	1: 59,958,353	S288N	possibly damaging	Het
Fam216a	A	T	5: 122,367,646	M110K	probably damaging	Het
Frem3	T	A	8: 80,613,952	I958N	possibly damaging	Het
Gab1	T	A	8: 80,800,116	N118Y	probably damaging	Het
Gda	T	A	19: 21,409,887	I251L	probably benign	Het
Gli2	C	A	1: 118,844,460	R505L	probably damaging	Het
Gm5093	A	T	17: 46,439,738	I121N	possibly damaging	Het
Gpnmb	C	T	6: 49,048,015	S327L	probably benign	Het
Gpr156	T	A	16: 37,992,141	Y280N	probably damaging	Het
Gria4	A	G	9: 4,427,071	Y790H	probably damaging	Het
Guf1	C	A	5: 69,566,352		probably null	Het
H6pd	T	C	4: 149,982,573	E452G	possibly damaging	Het
Herc1	T	A	9: 66,386,838	Y487*	probably null	Het
Ifi30	T	A	8: 70,764,949		probably benign	Het
Klf13	G	A	7: 63,938,071	A159V	possibly damaging	Het
Med11	T	A	11: 70,453,226	M124K	possibly damaging	Het
Myom3	A	G	4: 135,788,426		probably benign	Het
Nat2	A	T	8: 67,501,804	I189F	probably damaging	Het
Nhlrc4	C	G	17: 25,943,684	G30R	probably damaging	Het
Nkx3-2	G	A	5: 41,762,127	R173C	probably damaging	Het
Nox3	T	C	17: 3,695,564	N23S	probably damaging	Het
Npr2	A	T	4: 43,646,991	Y708F	probably damaging	Het
Nsun2	A	G	13: 69,629,542	N409S	probably benign	Het
Nucb2	T	C	7: 116,535,851		probably benign	Het
Olfr1105	A	G	2: 87,033,882	F113S	probably damaging	Het
Olfr541	T	C	7: 140,704,787	F179L	possibly damaging	Het
Olfr874	T	C	9: 37,746,217	F28L	probably benign	Het
Orai2	A	T	5: 136,161,599	V52D	probably damaging	Het
Pcyox1	A	T	6: 86,394,442	M154K	probably damaging	Het
Pik3r4	C	A	9: 105,653,976	T492K	possibly damaging	Het
Pmpca	T	A	2: 26,391,097	Y150N	probably damaging	Het
Ppp1r12b	G	T	1: 134,876,082	S446R	probably damaging	Het
Ptpdc1	A	G	13: 48,586,905	I289T	probably benign	Het
Pyroxd2	A	G	19: 42,727,642		probably benign	Het
Qrfpr	G	A	3: 36,189,559	T131M	probably damaging	Het
Rab33b	A	G	3: 51,493,417	Y104C	probably damaging	Het
Rad54l	G	T	4: 116,099,750		probably benign	Het
Rad9a	A	T	19: 4,197,360		probably null	Het
Slc1a5	A	T	7: 16,786,904	M233L	probably benign	Het
Slc47a2	C	T	11: 61,342,504	V67I	possibly damaging	Het
Slco1a5	T	A	6: 142,268,278	Y39F	probably benign	Het
Slfn5	T	C	11: 82,961,403	V785A	probably damaging	Het
Sp6	C	T	11: 97,021,544	P28S	possibly damaging	Het
Sptbn5	A	G	2: 120,062,675		probably null	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
St8sia1	A	G	6: 142,829,254	W200R	probably damaging	Het
Syne1	A	G	10: 5,033,138		probably benign	Het
Thbs3	T	A	3: 89,220,165	I371N	possibly damaging	Het
Tll1	C	T	8: 64,074,290	S399N	probably damaging	Het
Tmem209	A	C	6: 30,505,834	C114G	probably null	Het
Tmem25	C	T	9: 44,795,514		probably benign	Het
Tmem8b	T	C	4: 43,674,562	I282T	possibly damaging	Het
Trdmt1	T	A	2: 13,544,580	H18L	probably benign	Het
Trim63	A	G	4: 134,316,405	T60A	probably benign	Het
Trpv2	T	C	11: 62,584,676		probably null	Het
Ubr2	A	T	17: 46,938,653	I1591K	probably damaging	Het
Use1	A	T	8: 71,367,065		probably benign	Het
Zfp850	A	T	7: 27,985,217	C35S	possibly damaging	Het

Other mutations in Stxbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01989:Stxbp1	APN	2	32812064	missense	probably benign	0.00
IGL02743:Stxbp1	APN	2	32819901	missense	probably damaging	0.98
volume	UTSW	2	32801893	missense	probably damaging	0.99
volume2	UTSW	2	32801883	missense	possibly damaging	0.95
P0021:Stxbp1	UTSW	2	32823538	missense	probably damaging	0.96
R0217:Stxbp1	UTSW	2	32801870	missense	possibly damaging	0.69
R0269:Stxbp1	UTSW	2	32802783	missense	probably damaging	1.00
R0285:Stxbp1	UTSW	2	32823542	missense	probably benign	0.00
R0335:Stxbp1	UTSW	2	32802905	splice site	probably benign
R0565:Stxbp1	UTSW	2	32819848	missense	probably benign	0.07
R0617:Stxbp1	UTSW	2	32802783	missense	probably damaging	1.00
R1022:Stxbp1	UTSW	2	32814967	splice site	probably null
R1024:Stxbp1	UTSW	2	32814967	splice site	probably null
R1295:Stxbp1	UTSW	2	32794636	missense	probably benign	0.18
R1296:Stxbp1	UTSW	2	32794636	missense	probably benign	0.18
R1472:Stxbp1	UTSW	2	32794636	missense	probably benign	0.18
R1699:Stxbp1	UTSW	2	32800617	missense	probably damaging	0.99
R1744:Stxbp1	UTSW	2	32806719	critical splice donor site	probably null
R2004:Stxbp1	UTSW	2	32798189	missense	probably damaging	0.99
R2151:Stxbp1	UTSW	2	32802856	missense	probably damaging	1.00
R2153:Stxbp1	UTSW	2	32802856	missense	probably damaging	1.00
R2154:Stxbp1	UTSW	2	32802856	missense	probably damaging	1.00
R5170:Stxbp1	UTSW	2	32794674	missense	probably benign	0.01
R6083:Stxbp1	UTSW	2	32796018	missense	possibly damaging	0.95
R6295:Stxbp1	UTSW	2	32794609	missense	probably damaging	0.98
R6504:Stxbp1	UTSW	2	32801883	missense	possibly damaging	0.95
R6770:Stxbp1	UTSW	2	32819889	missense	probably benign	0.01
R6954:Stxbp1	UTSW	2	32801893	missense	probably damaging	0.99
R7283:Stxbp1	UTSW	2	32815014	missense	probably damaging	1.00
R7382:Stxbp1	UTSW	2	32798168	missense	probably damaging	1.00
R7541:Stxbp1	UTSW	2	32818505	missense	probably damaging	0.99
R7734:Stxbp1	UTSW	2	32801820	missense	probably benign	0.00
R8364:Stxbp1	UTSW	2	32806762	missense	possibly damaging	0.72
R8462:Stxbp1	UTSW	2	32817281	splice site	probably null
R9143:Stxbp1	UTSW	2	32798145	missense	probably damaging	0.99
R9246:Stxbp1	UTSW	2	32789574	missense	possibly damaging	0.85
R9267:Stxbp1	UTSW	2	32818505	missense	probably damaging	1.00
RF010:Stxbp1	UTSW	2	32821915	missense	probably benign	0.06
X0060:Stxbp1	UTSW	2	32802768	missense	probably damaging	1.00
Z1177:Stxbp1	UTSW	2	32802754	missense	probably null	1.00
Z1177:Stxbp1	UTSW	2	32809128	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGTTGGAACTTGGACCACCTACTG -3'
(R):5'- AACTGCCCATGCTGCTACACAGAG -3'

Sequencing Primer
(F):5'- CTTGGACCACCTACTGAAGAG -3'
(R):5'- cagagaaactctgtctcaaagaatc -3'

Posted On

2013-07-30