Incidental Mutation 'R7952:Unc13d'
ID613155
Institutional Source Beutler Lab
Gene Symbol Unc13d
Ensembl Gene ENSMUSG00000057948
Gene Nameunc-13 homolog D (C. elegans)
Synonyms2610108D09Rik, Munc13-4, Jinx
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7952 (G1)
Quality Score163.009
Status Not validated
Chromosome11
Chromosomal Location116062095-116077961 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 116064941 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000075036] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000106452] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect probably benign
Transcript: ENSMUST00000021116
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000075036
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106450
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106451
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106452
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174822
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the UNC13 family, containing similar domain structure as other family members but lacking an N-terminal phorbol ester-binding C1 domain present in other Munc13 proteins. The protein appears to play a role in vesicle maturation during exocytosis and is involved in regulation of cytolytic granules secretion. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis type 3, a genetically heterogeneous, rare autosomal recessive disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted deletion of this gene leads to defective hemostasis, abrogated thrombus formation and protection of homozygotes from ischemic stroke in the absence of intracranial bleeding. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,184,135 R738C possibly damaging Het
Acot12 G A 13: 91,771,725 V260M probably benign Het
Alkbh8 A T 9: 3,359,503 H264L probably damaging Het
Arfgef2 C T 2: 166,873,703 T1356I probably damaging Het
Arhgap27 A T 11: 103,360,304 N199K probably damaging Het
Asic2 T C 11: 81,967,998 R63G probably damaging Het
Aspa T A 11: 73,313,552 M197L probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Brdt A T 5: 107,370,179 I723L probably benign Het
C2cd3 T A 7: 100,469,491 F2312Y probably damaging Het
Cacng5 C T 11: 107,881,592 probably null Het
Cd19 T C 7: 126,410,526 N456S probably damaging Het
Ceacam1 G T 7: 25,476,529 A80E probably damaging Het
Cep135 T C 5: 76,640,956 V1132A probably benign Het
Cep85 A G 4: 134,132,298 C687R probably damaging Het
Cln5 A G 14: 103,076,065 Y251C probably damaging Het
Crygc A G 1: 65,071,855 M91T possibly damaging Het
Ddt T C 10: 75,773,226 K33R probably damaging Het
Dhfr G A 13: 92,357,963 W58* probably null Het
Dhx40 T C 11: 86,797,706 E297G probably benign Het
Dner T C 1: 84,383,881 Y669C probably benign Het
Dpys G T 15: 39,793,386 F428L probably damaging Het
Dspp A C 5: 104,175,665 T225P probably damaging Het
Elac2 A G 11: 64,999,387 K656E probably damaging Het
Ern1 T A 11: 106,459,019 R24* probably null Het
F2rl2 T C 13: 95,701,011 I188T probably damaging Het
Fam83b C T 9: 76,492,144 C559Y possibly damaging Het
Fat1 T G 8: 45,051,222 F4584C probably benign Het
Gabra6 G A 11: 42,316,495 T254I possibly damaging Het
Garem1 T C 18: 21,299,700 D24G probably damaging Het
Gas2l2 A T 11: 83,421,990 L832* probably null Het
Gpr68 C T 12: 100,879,238 D16N probably benign Het
Il17b T C 18: 61,692,409 I172T probably damaging Het
Ildr2 T G 1: 166,309,292 S567A probably benign Het
Kalrn A G 16: 33,988,847 V2557A probably damaging Het
Kif1b A G 4: 149,184,376 S1627P probably benign Het
Kif5a G A 10: 127,243,474 T285M probably damaging Het
Lrif1 G A 3: 106,733,143 probably null Het
Lrrn2 C T 1: 132,939,378 T727I unknown Het
Lsg1 T C 16: 30,564,722 E560G probably benign Het
Map4k4 C A 1: 39,974,044 Q100K unknown Het
Mipep A T 14: 60,802,936 R302W probably damaging Het
Morf4l1 G T 9: 90,093,791 T316K probably damaging Het
Mov10 A T 3: 104,804,678 V126E probably damaging Het
Muc2 T A 7: 141,749,734 C559S Het
Myh7 A G 14: 54,989,073 Y410H probably damaging Het
Nf1 T A 11: 79,418,588 Y433N probably damaging Het
Nmd3 T C 3: 69,726,417 L79P probably damaging Het
Nol10 G T 12: 17,358,238 S155I probably null Het
Olfr1208 T C 2: 88,897,064 I178V probably benign Het
Olfr134 T C 17: 38,175,939 L285P possibly damaging Het
Olfr1448 A G 19: 12,919,547 I254T probably benign Het
Olfr668 T A 7: 104,925,104 Y220F probably damaging Het
Pde3b T C 7: 114,494,687 S389P probably benign Het
Polr1c C T 17: 46,244,891 G188D probably benign Het
Polrmt C T 10: 79,741,983 probably null Het
Prpf31 A G 7: 3,630,860 M65V probably benign Het
Pum2 A G 12: 8,713,595 T251A probably benign Het
Rabgap1 G A 2: 37,487,130 V325I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl15 G T 14: 18,269,017 Y203* probably null Het
Sac3d1 G A 19: 6,118,426 P54L possibly damaging Het
Serpina3g A G 12: 104,240,251 I104V probably benign Het
Setd2 C T 9: 110,550,014 Q966* probably null Het
Simc1 G T 13: 54,503,900 D9Y unknown Het
Slc5a8 T C 10: 88,921,705 L519S probably benign Het
Srcap C A 7: 127,539,194 Q1179K possibly damaging Het
Srd5a3 T C 5: 76,147,736 L91P probably damaging Het
Stab1 T C 14: 31,154,472 T887A probably benign Het
Sult2a6 A G 7: 14,254,812 F8L not run Het
Thsd7a A T 6: 12,471,124 C498* probably null Het
Timp4 T C 6: 115,250,394 I75V probably benign Het
Tspyl4 T A 10: 34,298,100 M196K probably damaging Het
Ubr2 T C 17: 46,991,008 E172G probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13c T G 9: 73,694,877 L1362F probably damaging Het
Vmn2r11 A G 5: 109,052,120 V489A probably damaging Het
Vps39 T C 2: 120,339,394 T226A possibly damaging Het
Zan C T 5: 137,473,601 E185K probably damaging Het
Other mutations in Unc13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Unc13d APN 11 116074403 missense probably damaging 0.99
IGL00976:Unc13d APN 11 116070467 missense probably damaging 1.00
IGL01630:Unc13d APN 11 116073866 missense probably benign 0.00
IGL01761:Unc13d APN 11 116073869 missense probably damaging 1.00
IGL01772:Unc13d APN 11 116076532 missense possibly damaging 0.91
IGL01935:Unc13d APN 11 116069751 missense probably benign
IGL02486:Unc13d APN 11 116069806 splice site probably benign
IGL02503:Unc13d APN 11 116068802 missense possibly damaging 0.82
IGL02519:Unc13d APN 11 116070533 missense probably damaging 1.00
IGL02524:Unc13d APN 11 116070319 missense probably damaging 1.00
IGL02634:Unc13d APN 11 116070556 splice site probably benign
IGL02636:Unc13d APN 11 116073618 missense probably damaging 1.00
IGL03243:Unc13d APN 11 116067844 missense probably benign 0.34
jinx UTSW 11 116073423 unclassified probably benign
R0033:Unc13d UTSW 11 116069165 missense probably benign 0.00
R0084:Unc13d UTSW 11 116063831 missense probably damaging 1.00
R0122:Unc13d UTSW 11 116065482 missense probably benign 0.00
R0422:Unc13d UTSW 11 116070020 critical splice donor site probably null
R0666:Unc13d UTSW 11 116069492 splice site probably benign
R1019:Unc13d UTSW 11 116068074 missense probably benign 0.03
R1333:Unc13d UTSW 11 116073555 splice site probably benign
R1484:Unc13d UTSW 11 116073875 missense possibly damaging 0.72
R1594:Unc13d UTSW 11 116068712 missense probably benign 0.04
R1597:Unc13d UTSW 11 116074436 missense probably benign 0.02
R1603:Unc13d UTSW 11 116073655 missense possibly damaging 0.86
R1662:Unc13d UTSW 11 116068673 missense probably null 1.00
R1909:Unc13d UTSW 11 116070295 missense probably damaging 0.99
R2015:Unc13d UTSW 11 116068755 missense probably damaging 1.00
R2313:Unc13d UTSW 11 116063734 missense probably damaging 1.00
R2435:Unc13d UTSW 11 116068688 missense probably damaging 1.00
R4705:Unc13d UTSW 11 116073388 missense possibly damaging 0.70
R4732:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4733:Unc13d UTSW 11 116073582 missense possibly damaging 0.91
R4792:Unc13d UTSW 11 116070282 missense probably damaging 1.00
R4843:Unc13d UTSW 11 116074259 missense probably damaging 1.00
R5496:Unc13d UTSW 11 116066708 missense probably damaging 1.00
R5571:Unc13d UTSW 11 116063654 missense probably benign 0.00
R5589:Unc13d UTSW 11 116069753 missense probably damaging 0.99
R5838:Unc13d UTSW 11 116064625 missense possibly damaging 0.80
R6058:Unc13d UTSW 11 116073568 critical splice donor site probably null
R6266:Unc13d UTSW 11 116068238 missense probably damaging 1.00
R6807:Unc13d UTSW 11 116066751 missense probably damaging 0.98
R7085:Unc13d UTSW 11 116064807 missense probably benign 0.07
R7098:Unc13d UTSW 11 116063726 missense probably damaging 1.00
R7269:Unc13d UTSW 11 116068230 missense probably benign 0.01
R7291:Unc13d UTSW 11 116074050 missense possibly damaging 0.79
R7453:Unc13d UTSW 11 116067871 missense probably benign
R7486:Unc13d UTSW 11 116074433 missense possibly damaging 0.68
R7618:Unc13d UTSW 11 116066721 missense probably damaging 1.00
R7817:Unc13d UTSW 11 116076283 missense probably damaging 1.00
X0027:Unc13d UTSW 11 116069756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGGCTGCAGAAGTACTTC -3'
(R):5'- GCTATGTCATTCAGGAAACCAAG -3'

Sequencing Primer
(F):5'- GAAGTACTTCTGGATAAGCTCCCG -3'
(R):5'- GAAAAGTTGGGCCTCTTATCCAG -3'
Posted On2019-12-27