Incidental Mutation 'R7953:Rax'
ID613234
Institutional Source Beutler Lab
Gene Symbol Rax
Ensembl Gene ENSMUSG00000024518
Gene Nameretina and anterior neural fold homeobox
Synonymsey1, Rx, E130303K03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.620) question?
Stock #R7953 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location65934639-65939089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65938213 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 117 (V117A)
Ref Sequence ENSEMBL: ENSMUSP00000025396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025396]
Predicted Effect probably benign
Transcript: ENSMUST00000025396
AA Change: V117A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025396
Gene: ENSMUSG00000024518
AA Change: V117A

DomainStartEndE-ValueType
low complexity region 128 135 N/A INTRINSIC
HOX 136 198 1.25e-27 SMART
low complexity region 207 253 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
Pfam:OAR 314 334 1.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mutants die neonatally with severe brain defects including absence of forebrain/midbrain structures and fail to form eye structures. Homozygous hypomorph mutants are viable, but lack eyes and optic tracts and have hypothalamic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,605,643 F171L probably benign Het
2410137M14Rik A T 17: 36,978,017 C152S unknown Het
Alb T C 5: 90,472,629 F533L possibly damaging Het
Alox12b T C 11: 69,169,309 M616T possibly damaging Het
Atxn2l A G 7: 126,492,752 F968L probably benign Het
Cadps2 G T 6: 23,263,642 H1227Q probably benign Het
Cdh18 A T 15: 23,474,327 D761V possibly damaging Het
Cdkl3 T C 11: 52,018,457 probably null Het
Chrdl2 T C 7: 100,010,042 L9P unknown Het
Ctr9 A G 7: 111,052,411 E946G unknown Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Cyp2c67 A C 19: 39,609,225 M443R probably damaging Het
Dnah12 A G 14: 26,856,529 T3082A probably benign Het
Flnc C T 6: 29,454,307 T1906I probably damaging Het
Gm14496 A G 2: 181,996,113 I327V probably benign Het
Gm29106 T A 1: 118,199,155 N192K possibly damaging Het
H3f3a A T 1: 180,811,925 M1K probably null Het
Htt T A 5: 34,898,547 W2601R possibly damaging Het
Il18r1 T A 1: 40,491,136 I341K probably benign Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Lrp3 C A 7: 35,211,497 G41V probably damaging Het
Lrrc9 G T 12: 72,486,190 K944N probably damaging Het
Mettl21e T A 1: 44,210,211 E95V probably damaging Het
Mib1 G A 18: 10,798,446 R769Q possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Mymk A G 2: 27,062,286 S190P probably damaging Het
Neb G A 2: 52,325,749 P182L probably damaging Het
Nfil3 A G 13: 52,968,413 Y152H probably damaging Het
Nisch A G 14: 31,172,095 Y1174H probably damaging Het
Nyap1 G C 5: 137,735,396 Y458* probably null Het
Olfr183 G A 16: 58,999,723 V13I probably benign Het
Olfr618 T A 7: 103,598,266 C317S probably damaging Het
Olfr984 A C 9: 40,100,677 V271G possibly damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Patj G T 4: 98,424,316 G297V probably damaging Het
Pcdh9 A T 14: 93,887,257 S492R probably damaging Het
Pcyox1 G A 6: 86,392,341 R168C probably damaging Het
Plbd1 A T 6: 136,617,328 Y308N possibly damaging Het
Rdh9 C A 10: 127,776,697 N71K probably benign Het
Sap130 A G 18: 31,720,661 N968S probably benign Het
Sema5a A T 15: 32,609,339 I464F probably benign Het
Sez6l T G 5: 112,438,581 D683A probably damaging Het
Slit2 C A 5: 48,302,307 P1310T probably damaging Het
Snap47 T C 11: 59,438,078 M133V probably benign Het
Srcap G A 7: 127,560,558 S3202N unknown Het
Ssh2 T C 11: 77,453,615 W809R probably benign Het
Stau1 G T 2: 166,950,950 A365D possibly damaging Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Thbs1 A T 2: 118,115,027 N329I possibly damaging Het
Tmem65 A T 15: 58,787,161 D184E probably damaging Het
Trpm6 G T 19: 18,815,241 E676D probably benign Het
Vdr T G 15: 97,884,890 D17A possibly damaging Het
Vmn1r123 C T 7: 21,162,267 T28I probably damaging Het
Wdr90 A G 17: 25,860,539 L207P probably damaging Het
Zfp598 A G 17: 24,679,330 E402G probably damaging Het
Other mutations in Rax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rax APN 18 65938630 missense possibly damaging 0.68
IGL03290:Rax APN 18 65938160 missense probably damaging 1.00
R4210:Rax UTSW 18 65935081 missense unknown
R4211:Rax UTSW 18 65935081 missense unknown
R5138:Rax UTSW 18 65938318 intron probably benign
R6039:Rax UTSW 18 65935347 missense unknown
R6039:Rax UTSW 18 65935347 missense unknown
R6235:Rax UTSW 18 65935161 missense unknown
R6578:Rax UTSW 18 65938667 missense probably benign 0.02
R7870:Rax UTSW 18 65938213 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TACTTACCTGGACCCGAACC -3'
(R):5'- AAATTCTAGTGACCCCACATAGG -3'

Sequencing Primer
(F):5'- CTCGGGTAGGTTAACCTTGCC -3'
(R):5'- ACATAGGTCCCCATCGCG -3'
Posted On2019-12-27