Mutagenetix > Incidental Mutations

Incidental Mutation 'R0690:Rad54l'

61325

Institutional Source

Beutler Lab

Gene Symbol

Rad54l

Ensembl Gene

ENSMUSG00000028702

Gene Name

RAD54 like (S. cerevisiae)

Synonyms

RAD54

MMRRC Submission

038875-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0690 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116094264-116123690 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 116099750 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]

Predicted Effect

probably benign
Transcript: ENSMUST00000030471

SMART Domains

Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703

Domain	Start	End	E-Value	Type
low complexity region	30	45	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
low complexity region	314	325	N/A	INTRINSIC
low complexity region	352	382	N/A	INTRINSIC
low complexity region	417	429	N/A	INTRINSIC
SCOP:d1yrga_	449	742	4e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102704

SMART Domains

Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702

Domain	Start	End	E-Value	Type
DEXDc	149	357	1.66e-41	SMART
Blast:DEXDc	391	427	5e-13	BLAST
low complexity region	441	456	N/A	INTRINSIC
HELICc	527	611	1.39e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102705

SMART Domains

Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702

Domain	Start	End	E-Value	Type
Pfam:Rad54_N	10	138	7.8e-9	PFAM
DEXDc	149	357	1.66e-41	SMART
Blast:DEXDc	391	427	5e-13	BLAST
low complexity region	441	456	N/A	INTRINSIC
HELICc	527	611	1.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139147

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (87/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are sensitive to DNA crosslinking agents and to ionizing radiation and show abnormal definitive hematopoiesis following X-ray treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,969,808		probably benign	Het
Abi3	T	C	11: 95,833,634		probably benign	Het
Adam2	T	C	14: 66,057,646	N250S	probably damaging	Het
Agbl4	T	A	4: 111,657,388	I532K	probably benign	Het
Agrn	T	G	4: 156,174,453	E905A	probably damaging	Het
Ahi1	A	G	10: 20,970,843		probably benign	Het
Aifm2	A	G	10: 61,726,452	N89S	probably benign	Het
Arsj	C	T	3: 126,438,184	T193I	probably damaging	Het
Ascc2	T	A	11: 4,682,933	V702E	probably damaging	Het
Avpr1b	T	C	1: 131,600,281	S181P	probably damaging	Het
Bcl7a	G	A	5: 123,351,940	V56I	possibly damaging	Het
Cd160	T	A	3: 96,805,786	D54V	probably damaging	Het
Celsr2	C	A	3: 108,414,977	R173M	probably damaging	Het
Cfap57	A	G	4: 118,569,727		probably benign	Het
Cfap69	G	A	5: 5,663,951	T27I	probably damaging	Het
Chaf1b	T	C	16: 93,900,017		probably benign	Het
Cldn8	C	T	16: 88,562,639	V133M	probably damaging	Het
Col2a1	A	T	15: 97,980,192	V954E	unknown	Het
Col6a4	T	C	9: 106,028,187		probably benign	Het
Col6a6	T	C	9: 105,709,486	M1779V	probably benign	Het
Coq8b	A	G	7: 27,242,249	E253G	probably benign	Het
Ctse	T	C	1: 131,674,778		probably benign	Het
Cyp2c29	T	A	19: 39,309,726	N238K	probably benign	Het
Dcaf1	T	A	9: 106,846,649		probably benign	Het
Dcc	A	T	18: 71,809,204		probably benign	Het
Dkk1	A	G	19: 30,549,345	F12S	probably benign	Het
Dnah6	A	G	6: 73,129,474	V1760A	probably benign	Het
Fam117b	G	A	1: 59,958,353	S288N	possibly damaging	Het
Fam216a	A	T	5: 122,367,646	M110K	probably damaging	Het
Frem3	T	A	8: 80,613,952	I958N	possibly damaging	Het
Gab1	T	A	8: 80,800,116	N118Y	probably damaging	Het
Gda	T	A	19: 21,409,887	I251L	probably benign	Het
Gli2	C	A	1: 118,844,460	R505L	probably damaging	Het
Gm5093	A	T	17: 46,439,738	I121N	possibly damaging	Het
Gpnmb	C	T	6: 49,048,015	S327L	probably benign	Het
Gpr156	T	A	16: 37,992,141	Y280N	probably damaging	Het
Gria4	A	G	9: 4,427,071	Y790H	probably damaging	Het
Guf1	C	A	5: 69,566,352		probably null	Het
H6pd	T	C	4: 149,982,573	E452G	possibly damaging	Het
Herc1	T	A	9: 66,386,838	Y487*	probably null	Het
Ifi30	T	A	8: 70,764,949		probably benign	Het
Klf13	G	A	7: 63,938,071	A159V	possibly damaging	Het
Med11	T	A	11: 70,453,226	M124K	possibly damaging	Het
Myom3	A	G	4: 135,788,426		probably benign	Het
Nat2	A	T	8: 67,501,804	I189F	probably damaging	Het
Nhlrc4	C	G	17: 25,943,684	G30R	probably damaging	Het
Nkx3-2	G	A	5: 41,762,127	R173C	probably damaging	Het
Nox3	T	C	17: 3,695,564	N23S	probably damaging	Het
Npr2	A	T	4: 43,646,991	Y708F	probably damaging	Het
Nsun2	A	G	13: 69,629,542	N409S	probably benign	Het
Nucb2	T	C	7: 116,535,851		probably benign	Het
Olfr1105	A	G	2: 87,033,882	F113S	probably damaging	Het
Olfr541	T	C	7: 140,704,787	F179L	possibly damaging	Het
Olfr874	T	C	9: 37,746,217	F28L	probably benign	Het
Orai2	A	T	5: 136,161,599	V52D	probably damaging	Het
Pcyox1	A	T	6: 86,394,442	M154K	probably damaging	Het
Pik3r4	C	A	9: 105,653,976	T492K	possibly damaging	Het
Pmpca	T	A	2: 26,391,097	Y150N	probably damaging	Het
Ppp1r12b	G	T	1: 134,876,082	S446R	probably damaging	Het
Ptpdc1	A	G	13: 48,586,905	I289T	probably benign	Het
Pyroxd2	A	G	19: 42,727,642		probably benign	Het
Qrfpr	G	A	3: 36,189,559	T131M	probably damaging	Het
Rab33b	A	G	3: 51,493,417	Y104C	probably damaging	Het
Rad9a	A	T	19: 4,197,360		probably null	Het
Slc1a5	A	T	7: 16,786,904	M233L	probably benign	Het
Slc47a2	C	T	11: 61,342,504	V67I	possibly damaging	Het
Slco1a5	T	A	6: 142,268,278	Y39F	probably benign	Het
Slfn5	T	C	11: 82,961,403	V785A	probably damaging	Het
Sp6	C	T	11: 97,021,544	P28S	possibly damaging	Het
Sptbn5	A	G	2: 120,062,675		probably null	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
St8sia1	A	G	6: 142,829,254	W200R	probably damaging	Het
Stxbp1	C	A	2: 32,800,695		probably benign	Het
Syne1	A	G	10: 5,033,138		probably benign	Het
Thbs3	T	A	3: 89,220,165	I371N	possibly damaging	Het
Tll1	C	T	8: 64,074,290	S399N	probably damaging	Het
Tmem209	A	C	6: 30,505,834	C114G	probably null	Het
Tmem25	C	T	9: 44,795,514		probably benign	Het
Tmem8b	T	C	4: 43,674,562	I282T	possibly damaging	Het
Trdmt1	T	A	2: 13,544,580	H18L	probably benign	Het
Trim63	A	G	4: 134,316,405	T60A	probably benign	Het
Trpv2	T	C	11: 62,584,676		probably null	Het
Ubr2	A	T	17: 46,938,653	I1591K	probably damaging	Het
Use1	A	T	8: 71,367,065		probably benign	Het
Zfp850	A	T	7: 27,985,217	C35S	possibly damaging	Het

Other mutations in Rad54l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01409:Rad54l	APN	4	116105877	missense	probably damaging	1.00
IGL01569:Rad54l	APN	4	116098998	missense	probably damaging	1.00
IGL02120:Rad54l	APN	4	116098984	missense	probably benign	0.44
IGL02587:Rad54l	APN	4	116105797	missense	probably damaging	1.00
IGL02728:Rad54l	APN	4	116122949	missense	probably benign	0.00
IGL03114:Rad54l	APN	4	116098532	missense	probably damaging	1.00
R1179:Rad54l	UTSW	4	116111320	missense	probably benign	0.14
R1956:Rad54l	UTSW	4	116110357	missense	probably damaging	0.99
R2875:Rad54l	UTSW	4	116101853	missense	probably benign	0.00
R2936:Rad54l	UTSW	4	116122879	intron	probably benign
R4237:Rad54l	UTSW	4	116099449	missense	probably damaging	1.00
R4344:Rad54l	UTSW	4	116097354	missense	probably damaging	1.00
R4801:Rad54l	UTSW	4	116122924	missense	probably null	0.12
R4802:Rad54l	UTSW	4	116122924	missense	probably null	0.12
R5106:Rad54l	UTSW	4	116099764	intron	probably benign
R5644:Rad54l	UTSW	4	116098947	missense	probably benign
R5684:Rad54l	UTSW	4	116100563	missense	probably damaging	1.00
R5883:Rad54l	UTSW	4	116099046	intron	probably benign
R5963:Rad54l	UTSW	4	116110387	missense	probably damaging	1.00
R6035:Rad54l	UTSW	4	116097469	missense	probably damaging	1.00
R6035:Rad54l	UTSW	4	116097469	missense	probably damaging	1.00
R6369:Rad54l	UTSW	4	116111189	critical splice donor site	probably null
R6863:Rad54l	UTSW	4	116099669	missense	probably damaging	1.00
R7135:Rad54l	UTSW	4	116105830	missense	probably damaging	1.00
R7318:Rad54l	UTSW	4	116110709	missense	possibly damaging	0.91
R7767:Rad54l	UTSW	4	116099669	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGCTTTCAGACAGGATAGCTTC -3'
(R):5'- GGCTTCCAGATGATACTGGCTACAC -3'

Sequencing Primer
(F):5'- GCTTCAGCACAGAGGTAATTTCC -3'
(R):5'- GATGATACTGGCTACACCCTGTG -3'

Posted On

2013-07-30