Mutagenetix > Incidental Mutations

Incidental Mutation 'R0690:Cfap57'

61326

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

038875-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0690 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 118569727 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

Predicted Effect

probably benign
Transcript: ENSMUST00000071972

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (87/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,969,808		probably benign	Het
Abi3	T	C	11: 95,833,634		probably benign	Het
Adam2	T	C	14: 66,057,646	N250S	probably damaging	Het
Agbl4	T	A	4: 111,657,388	I532K	probably benign	Het
Agrn	T	G	4: 156,174,453	E905A	probably damaging	Het
Ahi1	A	G	10: 20,970,843		probably benign	Het
Aifm2	A	G	10: 61,726,452	N89S	probably benign	Het
Arsj	C	T	3: 126,438,184	T193I	probably damaging	Het
Ascc2	T	A	11: 4,682,933	V702E	probably damaging	Het
Avpr1b	T	C	1: 131,600,281	S181P	probably damaging	Het
Bcl7a	G	A	5: 123,351,940	V56I	possibly damaging	Het
Cd160	T	A	3: 96,805,786	D54V	probably damaging	Het
Celsr2	C	A	3: 108,414,977	R173M	probably damaging	Het
Cfap69	G	A	5: 5,663,951	T27I	probably damaging	Het
Chaf1b	T	C	16: 93,900,017		probably benign	Het
Cldn8	C	T	16: 88,562,639	V133M	probably damaging	Het
Col2a1	A	T	15: 97,980,192	V954E	unknown	Het
Col6a4	T	C	9: 106,028,187		probably benign	Het
Col6a6	T	C	9: 105,709,486	M1779V	probably benign	Het
Coq8b	A	G	7: 27,242,249	E253G	probably benign	Het
Ctse	T	C	1: 131,674,778		probably benign	Het
Cyp2c29	T	A	19: 39,309,726	N238K	probably benign	Het
Dcaf1	T	A	9: 106,846,649		probably benign	Het
Dcc	A	T	18: 71,809,204		probably benign	Het
Dkk1	A	G	19: 30,549,345	F12S	probably benign	Het
Dnah6	A	G	6: 73,129,474	V1760A	probably benign	Het
Fam117b	G	A	1: 59,958,353	S288N	possibly damaging	Het
Fam216a	A	T	5: 122,367,646	M110K	probably damaging	Het
Frem3	T	A	8: 80,613,952	I958N	possibly damaging	Het
Gab1	T	A	8: 80,800,116	N118Y	probably damaging	Het
Gda	T	A	19: 21,409,887	I251L	probably benign	Het
Gli2	C	A	1: 118,844,460	R505L	probably damaging	Het
Gm5093	A	T	17: 46,439,738	I121N	possibly damaging	Het
Gpnmb	C	T	6: 49,048,015	S327L	probably benign	Het
Gpr156	T	A	16: 37,992,141	Y280N	probably damaging	Het
Gria4	A	G	9: 4,427,071	Y790H	probably damaging	Het
Guf1	C	A	5: 69,566,352		probably null	Het
H6pd	T	C	4: 149,982,573	E452G	possibly damaging	Het
Herc1	T	A	9: 66,386,838	Y487*	probably null	Het
Ifi30	T	A	8: 70,764,949		probably benign	Het
Klf13	G	A	7: 63,938,071	A159V	possibly damaging	Het
Med11	T	A	11: 70,453,226	M124K	possibly damaging	Het
Myom3	A	G	4: 135,788,426		probably benign	Het
Nat2	A	T	8: 67,501,804	I189F	probably damaging	Het
Nhlrc4	C	G	17: 25,943,684	G30R	probably damaging	Het
Nkx3-2	G	A	5: 41,762,127	R173C	probably damaging	Het
Nox3	T	C	17: 3,695,564	N23S	probably damaging	Het
Npr2	A	T	4: 43,646,991	Y708F	probably damaging	Het
Nsun2	A	G	13: 69,629,542	N409S	probably benign	Het
Nucb2	T	C	7: 116,535,851		probably benign	Het
Olfr1105	A	G	2: 87,033,882	F113S	probably damaging	Het
Olfr541	T	C	7: 140,704,787	F179L	possibly damaging	Het
Olfr874	T	C	9: 37,746,217	F28L	probably benign	Het
Orai2	A	T	5: 136,161,599	V52D	probably damaging	Het
Pcyox1	A	T	6: 86,394,442	M154K	probably damaging	Het
Pik3r4	C	A	9: 105,653,976	T492K	possibly damaging	Het
Pmpca	T	A	2: 26,391,097	Y150N	probably damaging	Het
Ppp1r12b	G	T	1: 134,876,082	S446R	probably damaging	Het
Ptpdc1	A	G	13: 48,586,905	I289T	probably benign	Het
Pyroxd2	A	G	19: 42,727,642		probably benign	Het
Qrfpr	G	A	3: 36,189,559	T131M	probably damaging	Het
Rab33b	A	G	3: 51,493,417	Y104C	probably damaging	Het
Rad54l	G	T	4: 116,099,750		probably benign	Het
Rad9a	A	T	19: 4,197,360		probably null	Het
Slc1a5	A	T	7: 16,786,904	M233L	probably benign	Het
Slc47a2	C	T	11: 61,342,504	V67I	possibly damaging	Het
Slco1a5	T	A	6: 142,268,278	Y39F	probably benign	Het
Slfn5	T	C	11: 82,961,403	V785A	probably damaging	Het
Sp6	C	T	11: 97,021,544	P28S	possibly damaging	Het
Sptbn5	A	G	2: 120,062,675		probably null	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944		probably benign	Het
St8sia1	A	G	6: 142,829,254	W200R	probably damaging	Het
Stxbp1	C	A	2: 32,800,695		probably benign	Het
Syne1	A	G	10: 5,033,138		probably benign	Het
Thbs3	T	A	3: 89,220,165	I371N	possibly damaging	Het
Tll1	C	T	8: 64,074,290	S399N	probably damaging	Het
Tmem209	A	C	6: 30,505,834	C114G	probably null	Het
Tmem25	C	T	9: 44,795,514		probably benign	Het
Tmem8b	T	C	4: 43,674,562	I282T	possibly damaging	Het
Trdmt1	T	A	2: 13,544,580	H18L	probably benign	Het
Trim63	A	G	4: 134,316,405	T60A	probably benign	Het
Trpv2	T	C	11: 62,584,676		probably null	Het
Ubr2	A	T	17: 46,938,653	I1591K	probably damaging	Het
Use1	A	T	8: 71,367,065		probably benign	Het
Zfp850	A	T	7: 27,985,217	C35S	possibly damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTTGAGCGTGGCAAGGTTCC -3'
(R):5'- CCCAGGCAGGTACACAAGCATTTC -3'

Sequencing Primer
(F):5'- TGGCAAGGTTCCTCTCCAG -3'
(R):5'- ATTTCAGAACGGCGACCTTTG -3'

Posted On

2013-07-30