Incidental Mutation 'R7954:Nuggc'
ID613289
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7954 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65623251 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 449 (T449A)
Ref Sequence ENSEMBL: ENSMUSP00000078434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect probably benign
Transcript: ENSMUST00000079469
AA Change: T449A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: T449A

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150897
AA Change: T433A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: T433A

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,183,226 S1041P probably benign Het
Arpin A T 7: 79,927,715 W195R probably damaging Het
Asap1 A G 15: 64,092,076 V1091A probably damaging Het
Asxl3 A G 18: 22,524,224 T1764A not run Het
Bmp7 C A 2: 172,939,991 A27S probably benign Het
Ccnh T A 13: 85,211,872 Y297* probably null Het
Ccno C A 13: 112,988,113 D72E probably benign Het
Cd70 T G 17: 57,148,770 T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,687,400 probably null Het
Chst4 A G 8: 110,030,913 F106S probably damaging Het
Cntnap3 A C 13: 64,903,773 L23R probably benign Het
Crybg2 T A 4: 134,087,599 L1288H probably damaging Het
Cyfip2 T C 11: 46,242,350 H841R probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp4f18 G A 8: 71,988,643 P498S possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dnah3 T A 7: 119,967,552 I97F Het
Entpd3 A G 9: 120,560,586 R313G possibly damaging Het
Erg28 G A 12: 85,819,479 T75I probably damaging Het
Fam171a1 A G 2: 3,225,384 H518R probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Galntl6 T C 8: 57,837,188 E457G probably damaging Het
Glt8d1 A T 14: 31,010,339 H192L probably damaging Het
Gm15446 T A 5: 109,943,299 C472* probably null Het
Gm28363 A T 1: 117,697,498 M1L unknown Het
Gstp3 T A 19: 4,058,746 K45* probably null Het
Hsd17b13 A G 5: 103,965,815 F258L possibly damaging Het
Htt T C 5: 34,864,649 S1646P probably benign Het
Ipo11 T C 13: 106,892,468 M326V probably benign Het
Itpr3 T A 17: 27,117,179 I2293N probably damaging Het
Klk8 A G 7: 43,799,326 probably null Het
Kntc1 T A 5: 123,784,227 L963H probably damaging Het
Lyst T A 13: 13,636,052 L769* probably null Het
Map3k13 A G 16: 21,921,596 S558G probably benign Het
Mbd1 G A 18: 74,274,057 probably null Het
Mep1a T C 17: 43,479,235 N408D probably benign Het
Mtrf1 A G 14: 79,406,938 T229A probably benign Het
Muc4 C T 16: 32,754,935 S1603L unknown Het
Myo1b A C 1: 51,779,580 I512S possibly damaging Het
N4bp2 A G 5: 65,807,103 I832V probably benign Het
Nadsyn1 T A 7: 143,798,496 K618* probably null Het
Ncstn T C 1: 172,075,456 D87G probably benign Het
Neurl4 T C 11: 69,903,186 V156A probably benign Het
Nfasc C A 1: 132,600,013 G885V not run Het
Nox4 A T 7: 87,314,127 Y180F possibly damaging Het
Olfr799 A G 10: 129,647,412 I95V probably benign Het
Pik3r4 T C 9: 105,663,117 S735P probably damaging Het
Ppp1r9b T C 11: 95,001,909 I645T probably damaging Het
Rras2 G A 7: 114,117,548 probably benign Het
Rtel1 T C 2: 181,321,029 M25T probably damaging Het
Serpinb3c T A 1: 107,273,153 Y178F possibly damaging Het
Sh3bp2 A G 5: 34,559,085 H280R not run Het
Six4 CT C 12: 73,104,239 probably benign Het
Skor1 T C 9: 63,146,501 E62G probably damaging Het
Slc22a22 T A 15: 57,263,355 N106I possibly damaging Het
Slc44a4 T A 17: 34,923,852 probably null Het
Sppl2c A G 11: 104,188,516 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stx5a T A 19: 8,755,118 W384R unknown Het
Topaz1 A G 9: 122,780,700 Y1111C possibly damaging Het
Ttbk1 T A 17: 46,446,238 M1157L probably benign Het
Ttn T C 2: 76,717,215 T32204A probably benign Het
Ttn T C 2: 76,748,145 T24135A probably damaging Het
Ttn T C 2: 76,965,137 E632G unknown Het
Vmn2r109 T C 17: 20,540,520 I858M probably benign Het
Vmn2r71 A T 7: 85,623,661 Q561L possibly damaging Het
Yme1l1 A G 2: 23,181,065 D271G probably damaging Het
Zfp629 A G 7: 127,611,995 F214S probably damaging Het
Zfp709 A G 8: 71,889,464 I246V probably benign Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGAGTTTGCTGAGAGTTCCC -3'
(R):5'- TGGTCTCAGACACACAATGC -3'

Sequencing Primer
(F):5'- CTGAGAGTTCCCTTGGGGC -3'
(R):5'- GTGATTATATGTGCACACAGACACG -3'
Posted On2019-12-27