Incidental Mutation 'R0690:Tmem209'
ID61333
Institutional Source Beutler Lab
Gene Symbol Tmem209
Ensembl Gene ENSMUSG00000029782
Gene Nametransmembrane protein 209
Synonyms2700094F01Rik
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R0690 (G1)
Quality Score84
Status Validated
Chromosome6
Chromosomal Location30479053-30509783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30505834 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 114 (C114G)
Ref Sequence ENSEMBL: ENSMUSP00000115567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031797] [ENSMUST00000064330] [ENSMUST00000102991] [ENSMUST00000115157] [ENSMUST00000115160] [ENSMUST00000138823] [ENSMUST00000148638] [ENSMUST00000151187] [ENSMUST00000154547] [ENSMUST00000222934] [ENSMUST00000222934] [ENSMUST00000222934] [ENSMUST00000222934]
Predicted Effect probably benign
Transcript: ENSMUST00000031797
SMART Domains Protein: ENSMUSP00000031797
Gene: ENSMUSG00000029784

DomainStartEndE-ValueType
Pfam:DUF4636 1 195 3.5e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064330
AA Change: C158G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067667
Gene: ENSMUSG00000029782
AA Change: C158G

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 343 4.1e-88 PFAM
Pfam:CytochromB561_N 341 438 2.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102991
AA Change: C158G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100056
Gene: ENSMUSG00000029782
AA Change: C158G

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 376 5.2e-107 PFAM
Pfam:CytochromB561_N 372 519 3.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115157
AA Change: C157G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110810
Gene: ENSMUSG00000029782
AA Change: C157G

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 560 4.8e-209 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115160
AA Change: C158G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110813
Gene: ENSMUSG00000029782
AA Change: C158G

DomainStartEndE-ValueType
Pfam:CytochromB561_N 6 560 6.4e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138823
AA Change: C158G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138292
Gene: ENSMUSG00000029782
AA Change: C158G

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 560 1.2e-205 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148638
AA Change: C114G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115567
Gene: ENSMUSG00000029782
AA Change: C114G

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 71 1.3e-15 PFAM
Pfam:CytochromB561_N 67 139 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150480
Predicted Effect probably benign
Transcript: ENSMUST00000151187
SMART Domains Protein: ENSMUSP00000138232
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 1 403 1.5e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154547
SMART Domains Protein: ENSMUSP00000145248
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222934
Predicted Effect probably null
Transcript: ENSMUST00000222934
Predicted Effect probably null
Transcript: ENSMUST00000222934
Predicted Effect probably null
Transcript: ENSMUST00000222934
Meta Mutation Damage Score 0.2935 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Tmem209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Tmem209 APN 6 30487417 missense probably damaging 0.99
IGL01068:Tmem209 APN 6 30502086 missense probably benign 0.18
IGL02106:Tmem209 APN 6 30508660 splice site probably null
IGL02109:Tmem209 APN 6 30497945 missense probably damaging 1.00
IGL02250:Tmem209 APN 6 30487388 missense probably damaging 1.00
R0012:Tmem209 UTSW 6 30502113 splice site probably benign
R0426:Tmem209 UTSW 6 30491182 missense probably damaging 0.99
R0452:Tmem209 UTSW 6 30487381 missense probably damaging 1.00
R0557:Tmem209 UTSW 6 30501914 missense probably damaging 0.99
R1202:Tmem209 UTSW 6 30508790 missense probably benign 0.01
R1697:Tmem209 UTSW 6 30497868 missense probably benign 0.00
R3821:Tmem209 UTSW 6 30505960 missense probably damaging 1.00
R4795:Tmem209 UTSW 6 30501955 missense probably benign 0.00
R5131:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R5715:Tmem209 UTSW 6 30497923 nonsense probably null
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6030:Tmem209 UTSW 6 30482968 missense probably damaging 1.00
R6153:Tmem209 UTSW 6 30505795 missense probably benign 0.01
R6181:Tmem209 UTSW 6 30505971 missense probably damaging 1.00
R6256:Tmem209 UTSW 6 30497167 missense probably benign 0.00
R6721:Tmem209 UTSW 6 30497175 missense probably benign 0.00
R6873:Tmem209 UTSW 6 30508456 missense probably damaging 1.00
R7062:Tmem209 UTSW 6 30502017 missense probably damaging 1.00
R7341:Tmem209 UTSW 6 30494795 missense probably benign 0.00
R7461:Tmem209 UTSW 6 30508470 nonsense probably null
R7790:Tmem209 UTSW 6 30497855 missense probably damaging 1.00
R8354:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8454:Tmem209 UTSW 6 30489309 missense probably damaging 0.97
R8527:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
R8542:Tmem209 UTSW 6 30497238 missense probably damaging 1.00
RF020:Tmem209 UTSW 6 30487418 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGACCACTATGCTTTACTACTCCCCAAA -3'
(R):5'- TCCCTTCTAGTTGTGCAGACTACACC -3'

Sequencing Primer
(F):5'- CATGGTTAAAGAACTCCTGACTGAG -3'
(R):5'- CTCCCCGTGATTTGGCAG -3'
Posted On2013-07-30