Incidental Mutation 'R7958:Col1a2'
ID613528
Institutional Source Beutler Lab
Gene Symbol Col1a2
Ensembl Gene ENSMUSG00000029661
Gene Namecollagen, type I, alpha 2
SynonymsCola2, Cola-2, Col1a-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7958 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location4504814-4541544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4518500 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 213 (N213K)
Ref Sequence ENSEMBL: ENSMUSP00000031668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031668] [ENSMUST00000141483]
Predicted Effect unknown
Transcript: ENSMUST00000031668
AA Change: N213K
SMART Domains Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: N213K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 91 1e-8 PFAM
Pfam:Collagen 88 155 8.2e-10 PFAM
internal_repeat_3 172 223 7.52e-12 PROSPERO
low complexity region 225 271 N/A INTRINSIC
low complexity region 274 313 N/A INTRINSIC
low complexity region 316 352 N/A INTRINSIC
internal_repeat_2 354 386 2.06e-15 PROSPERO
internal_repeat_1 355 469 5.71e-17 PROSPERO
internal_repeat_4 361 472 2.1e-11 PROSPERO
Pfam:Collagen 475 535 7.7e-11 PFAM
Pfam:Collagen 521 588 8.2e-10 PFAM
low complexity region 598 625 N/A INTRINSIC
low complexity region 628 655 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 724 757 N/A INTRINSIC
low complexity region 759 784 N/A INTRINSIC
low complexity region 792 820 N/A INTRINSIC
internal_repeat_5 823 850 5.93e-7 PROSPERO
low complexity region 853 883 N/A INTRINSIC
Pfam:Collagen 895 969 1e-8 PFAM
low complexity region 987 1007 N/A INTRINSIC
internal_repeat_5 1009 1042 5.93e-7 PROSPERO
Pfam:Collagen 1051 1120 5.8e-9 PFAM
COLFI 1138 1372 2.1e-150 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141483
SMART Domains Protein: ENSMUSP00000125275
Gene: ENSMUSG00000029661

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Collagen 30 89 3.2e-10 PFAM
Pfam:Collagen 87 145 8.5e-10 PFAM
Pfam:Collagen 121 177 3.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Other mutations in Col1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Col1a2 APN 6 4531095 splice site probably benign
IGL01126:Col1a2 APN 6 4535846 missense unknown
IGL01129:Col1a2 APN 6 4535846 missense unknown
IGL01286:Col1a2 APN 6 4533891 missense unknown
IGL01687:Col1a2 APN 6 4520258 nonsense probably null
IGL01866:Col1a2 APN 6 4524132 missense probably damaging 1.00
IGL02010:Col1a2 APN 6 4512416 critical splice donor site probably null
IGL02100:Col1a2 APN 6 4524177 splice site probably benign
IGL02140:Col1a2 APN 6 4515639 missense unknown
IGL02474:Col1a2 APN 6 4516398 missense unknown
IGL02510:Col1a2 APN 6 4516398 missense unknown
IGL02525:Col1a2 APN 6 4531355 splice site probably benign
IGL02839:Col1a2 APN 6 4538748 missense unknown
IGL03134:Col1a2 APN 6 4521387 unclassified probably benign
IGL03385:Col1a2 APN 6 4539612 missense unknown
P4717OSA:Col1a2 UTSW 6 4518822 unclassified probably benign
PIT4453001:Col1a2 UTSW 6 4527079 missense possibly damaging 0.94
R0021:Col1a2 UTSW 6 4518822 unclassified probably benign
R0022:Col1a2 UTSW 6 4518822 unclassified probably benign
R0025:Col1a2 UTSW 6 4518822 unclassified probably benign
R0027:Col1a2 UTSW 6 4518822 unclassified probably benign
R0028:Col1a2 UTSW 6 4518822 unclassified probably benign
R0031:Col1a2 UTSW 6 4518822 unclassified probably benign
R0038:Col1a2 UTSW 6 4518822 unclassified probably benign
R0064:Col1a2 UTSW 6 4518822 unclassified probably benign
R0102:Col1a2 UTSW 6 4520775 missense possibly damaging 0.92
R0147:Col1a2 UTSW 6 4518822 unclassified probably benign
R0323:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4518822 unclassified probably benign
R0326:Col1a2 UTSW 6 4537838 missense unknown
R0335:Col1a2 UTSW 6 4531956 splice site probably benign
R0359:Col1a2 UTSW 6 4518822 unclassified probably benign
R0363:Col1a2 UTSW 6 4518822 unclassified probably benign
R0612:Col1a2 UTSW 6 4516003 missense unknown
R0729:Col1a2 UTSW 6 4518822 unclassified probably benign
R0746:Col1a2 UTSW 6 4518822 unclassified probably benign
R0760:Col1a2 UTSW 6 4518822 unclassified probably benign
R0761:Col1a2 UTSW 6 4518822 unclassified probably benign
R0801:Col1a2 UTSW 6 4531316 missense unknown
R0845:Col1a2 UTSW 6 4518822 unclassified probably benign
R0846:Col1a2 UTSW 6 4518822 unclassified probably benign
R0969:Col1a2 UTSW 6 4518822 unclassified probably benign
R0970:Col1a2 UTSW 6 4518822 unclassified probably benign
R1105:Col1a2 UTSW 6 4518822 unclassified probably benign
R1106:Col1a2 UTSW 6 4518822 unclassified probably benign
R1107:Col1a2 UTSW 6 4518822 unclassified probably benign
R1134:Col1a2 UTSW 6 4518822 unclassified probably benign
R1135:Col1a2 UTSW 6 4518822 unclassified probably benign
R1152:Col1a2 UTSW 6 4518822 unclassified probably benign
R1333:Col1a2 UTSW 6 4515684 critical splice donor site probably null
R1341:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1470:Col1a2 UTSW 6 4518822 unclassified probably benign
R1477:Col1a2 UTSW 6 4539673 missense unknown
R1566:Col1a2 UTSW 6 4523613 missense probably damaging 1.00
R1691:Col1a2 UTSW 6 4536038 missense unknown
R1713:Col1a2 UTSW 6 4538691 missense unknown
R1754:Col1a2 UTSW 6 4518822 unclassified probably benign
R1755:Col1a2 UTSW 6 4518822 unclassified probably benign
R2050:Col1a2 UTSW 6 4518822 unclassified probably benign
R2178:Col1a2 UTSW 6 4531143 missense unknown
R2194:Col1a2 UTSW 6 4518822 unclassified probably benign
R2195:Col1a2 UTSW 6 4518822 unclassified probably benign
R2235:Col1a2 UTSW 6 4518822 unclassified probably benign
R2261:Col1a2 UTSW 6 4518822 unclassified probably benign
R2262:Col1a2 UTSW 6 4518822 unclassified probably benign
R2263:Col1a2 UTSW 6 4518822 unclassified probably benign
R2289:Col1a2 UTSW 6 4518822 unclassified probably benign
R2310:Col1a2 UTSW 6 4518822 unclassified probably benign
R2312:Col1a2 UTSW 6 4518822 unclassified probably benign
R2330:Col1a2 UTSW 6 4528300 splice site probably benign
R2333:Col1a2 UTSW 6 4532747 missense unknown
R2401:Col1a2 UTSW 6 4518822 unclassified probably benign
R2403:Col1a2 UTSW 6 4518822 unclassified probably benign
R2448:Col1a2 UTSW 6 4518822 unclassified probably benign
R2513:Col1a2 UTSW 6 4531223 splice site probably null
R2862:Col1a2 UTSW 6 4518822 unclassified probably benign
R2884:Col1a2 UTSW 6 4518822 unclassified probably benign
R2885:Col1a2 UTSW 6 4518822 unclassified probably benign
R2913:Col1a2 UTSW 6 4519923 unclassified probably benign
R2937:Col1a2 UTSW 6 4519882 unclassified probably benign
R2937:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R2938:Col1a2 UTSW 6 4520788 missense possibly damaging 0.92
R3608:Col1a2 UTSW 6 4518822 unclassified probably benign
R3692:Col1a2 UTSW 6 4510710 missense possibly damaging 0.84
R3805:Col1a2 UTSW 6 4518822 unclassified probably benign
R3806:Col1a2 UTSW 6 4518822 unclassified probably benign
R3826:Col1a2 UTSW 6 4516960 unclassified probably benign
R3903:Col1a2 UTSW 6 4518822 unclassified probably benign
R3904:Col1a2 UTSW 6 4518822 unclassified probably benign
R3922:Col1a2 UTSW 6 4518822 unclassified probably benign
R3926:Col1a2 UTSW 6 4518822 unclassified probably benign
R4106:Col1a2 UTSW 6 4518822 unclassified probably benign
R4107:Col1a2 UTSW 6 4518822 unclassified probably benign
R4108:Col1a2 UTSW 6 4518822 unclassified probably benign
R4109:Col1a2 UTSW 6 4510705 nonsense probably null
R4509:Col1a2 UTSW 6 4518822 unclassified probably benign
R4667:Col1a2 UTSW 6 4512412 missense unknown
R4909:Col1a2 UTSW 6 4529058 splice site probably benign
R5418:Col1a2 UTSW 6 4516931 unclassified probably benign
R5587:Col1a2 UTSW 6 4540531 missense unknown
R5598:Col1a2 UTSW 6 4516916 unclassified probably benign
R5673:Col1a2 UTSW 6 4539622 missense unknown
R5678:Col1a2 UTSW 6 4536239 missense unknown
R5763:Col1a2 UTSW 6 4515682 missense unknown
R5786:Col1a2 UTSW 6 4530223 missense unknown
R5872:Col1a2 UTSW 6 4531926 missense unknown
R6084:Col1a2 UTSW 6 4505840 start codon destroyed probably benign 0.01
R6134:Col1a2 UTSW 6 4538035 missense unknown
R6221:Col1a2 UTSW 6 4539490 missense unknown
R6481:Col1a2 UTSW 6 4538680 missense unknown
R6500:Col1a2 UTSW 6 4515517 missense unknown
R6890:Col1a2 UTSW 6 4539587 missense unknown
R7022:Col1a2 UTSW 6 4534639 missense unknown
R7033:Col1a2 UTSW 6 4516904 unclassified probably benign
R7195:Col1a2 UTSW 6 4510753 missense unknown
R7657:Col1a2 UTSW 6 4527152 missense probably null 0.99
R7686:Col1a2 UTSW 6 4518964 missense unknown
R7875:Col1a2 UTSW 6 4518500 missense unknown
R8023:Col1a2 UTSW 6 4533847 missense unknown
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
V5622:Col1a2 UTSW 6 4518822 unclassified probably benign
X0017:Col1a2 UTSW 6 4515675 missense unknown
Z1176:Col1a2 UTSW 6 4532750 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGCCTGAGATCATTGAGAAATAGTC -3'
(R):5'- CAGAGGCAGCGCTTACTTTG -3'

Sequencing Primer
(F):5'- GAGTAAAAATTGTGCAATGTG -3'
(R):5'- TACAAGTGCTGTTCTAACACCAGG -3'
Posted On2019-12-27