Incidental Mutation 'R0690:Col6a4'
ID61354
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0690 (G1)
Quality Score162
Status Validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 106028187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably benign
Transcript: ENSMUST00000121963
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R8157:Col6a4 UTSW 9 106067898 missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 106076877 missense probably benign 0.01
R8309:Col6a4 UTSW 9 106075215 missense probably benign 0.08
R8336:Col6a4 UTSW 9 106075329 missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 106068384 missense probably benign 0.00
R8530:Col6a4 UTSW 9 106080505 missense probably benign 0.31
R8556:Col6a4 UTSW 9 106067053 missense probably damaging 0.96
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACATGGCTGATACCAATGCCAAC -3'
(R):5'- AACTTCAGGGCACAGCAGATCCTC -3'

Sequencing Primer
(F):5'- TGATACCAATGCCAACTTTGTC -3'
(R):5'- ACAATCCCGACTCAGTTTGGTAG -3'
Posted On2013-07-30