Incidental Mutation 'R7958:Thra'
ID613554
Institutional Source Beutler Lab
Gene Symbol Thra
Ensembl Gene ENSMUSG00000058756
Gene Namethyroid hormone receptor alpha
SynonymsTR alpha 1, Thra2, Thra1, Rvr, TR alpha 2, c-erbAalpha, 6430529J03Rik, Erba, Nr1a1, T3Ralpha, T3R[a]
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R7958 (G1)
Quality Score139.008
Status Not validated
Chromosome11
Chromosomal Location98740638-98769006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98768431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 462 (D462V)
Ref Sequence ENSEMBL: ENSMUSP00000068281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000064941] [ENSMUST00000103139] [ENSMUST00000124072]
Predicted Effect probably damaging
Transcript: ENSMUST00000064187
AA Change: D462V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756
AA Change: D462V

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064941
SMART Domains Protein: ENSMUSP00000069505
Gene: ENSMUSG00000020889

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
low complexity region 70 94 N/A INTRINSIC
ZnF_C4 130 202 5.54e-38 SMART
low complexity region 240 263 N/A INTRINSIC
PDB:3N00|A 282 361 2e-21 PDB
HOLI 442 600 4.2e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103139
SMART Domains Protein: ENSMUSP00000099428
Gene: ENSMUSG00000058756

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 7.26e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124072
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several nuclear hormone receptors that bind thyroid hormones such as triiodothyronine and thyroxine with high affinity. The encoded protein is a transcription factor that can activate or repress transcription. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene result in diverse phenotypes depending on the location and severity of the mutation. Observed phenotypes may include alterations in thyroid physiology, intestinal remodeling, cerebellum development, bone growth, cardiac function, thermogenesis, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Other mutations in Thra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Thra APN 11 98762928 missense possibly damaging 0.90
IGL01544:Thra APN 11 98756928 missense possibly damaging 0.46
IGL02377:Thra APN 11 98761916 missense probably damaging 1.00
IGL02738:Thra APN 11 98764359 missense probably benign 0.40
IGL03111:Thra APN 11 98761029 unclassified probably benign
California UTSW 11 98764308 missense probably damaging 0.97
Crissal UTSW 11 98762951 missense probably benign 0.20
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0959:Thra UTSW 11 98753629 missense possibly damaging 0.94
R1659:Thra UTSW 11 98756979 missense probably damaging 0.99
R1839:Thra UTSW 11 98756143 missense probably benign 0.01
R1859:Thra UTSW 11 98756151 missense probably damaging 0.98
R1935:Thra UTSW 11 98763073 splice site probably benign
R1956:Thra UTSW 11 98763741 missense probably benign 0.03
R4584:Thra UTSW 11 98764484 missense probably benign 0.42
R4782:Thra UTSW 11 98756164 missense probably benign 0.01
R5414:Thra UTSW 11 98760957 missense probably benign 0.34
R5790:Thra UTSW 11 98762951 missense probably benign 0.20
R5927:Thra UTSW 11 98763688 missense possibly damaging 0.56
R7207:Thra UTSW 11 98760976 missense probably damaging 1.00
R7234:Thra UTSW 11 98763718 missense probably damaging 1.00
R7307:Thra UTSW 11 98764308 missense probably damaging 0.97
R7825:Thra UTSW 11 98762948 missense probably benign 0.14
R7875:Thra UTSW 11 98768431 missense probably damaging 0.98
Z1177:Thra UTSW 11 98753481 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATGTTGTTCAGGGTCCGC -3'
(R):5'- GTCTCTGCAGGTGAGCCAAG -3'

Sequencing Primer
(F):5'- CAGGTCCGGCAGCTTGAG -3'
(R):5'- TCTAGCTTGGGAAACAGACTCATGC -3'
Posted On2019-12-27