Incidental Mutation 'R7958:Kbtbd7'
ID613559
Institutional Source Beutler Lab
Gene Symbol Kbtbd7
Ensembl Gene ENSMUSG00000043881
Gene Namekelch repeat and BTB (POZ) domain containing 7
Synonyms1110008P08Rik, LOC211255
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7958 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location79426511-79431036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79427366 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000060768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]
Predicted Effect probably benign
Transcript: ENSMUST00000022600
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061222
AA Change: T213A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881
AA Change: T213A

DomainStartEndE-ValueType
Blast:BTB 11 44 2e-11 BLAST
BTB 63 168 1.05e-23 SMART
BACK 173 279 1.41e-19 SMART
low complexity region 317 340 N/A INTRINSIC
Pfam:Kelch_1 434 481 1.7e-9 PFAM
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator, having been shown to increase the transcription of activator protein-1 and serum response element. The encoded protein can also form a complex with KBTBD6 and CUL3, which regulates the ubiquitylation and degradation of TIAM1, which is a regulator of RAC1. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Other mutations in Kbtbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Kbtbd7 APN 14 79428612 missense probably damaging 0.98
IGL01364:Kbtbd7 APN 14 79428046 missense possibly damaging 0.82
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0974:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R1236:Kbtbd7 UTSW 14 79427832 missense probably benign 0.05
R2909:Kbtbd7 UTSW 14 79428482 missense probably benign 0.16
R4731:Kbtbd7 UTSW 14 79428800 makesense probably null
R4732:Kbtbd7 UTSW 14 79428800 makesense probably null
R4733:Kbtbd7 UTSW 14 79428800 makesense probably null
R4984:Kbtbd7 UTSW 14 79427162 missense probably damaging 1.00
R5712:Kbtbd7 UTSW 14 79428765 missense possibly damaging 0.86
R6699:Kbtbd7 UTSW 14 79428192 missense probably benign 0.31
R7122:Kbtbd7 UTSW 14 79428317 missense probably damaging 0.98
R7176:Kbtbd7 UTSW 14 79427754 missense possibly damaging 0.77
R7457:Kbtbd7 UTSW 14 79427924 frame shift probably null
R7875:Kbtbd7 UTSW 14 79427366 missense probably benign 0.04
R8041:Kbtbd7 UTSW 14 79428704 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GATATGCTGCAGCTGGAGTAC -3'
(R):5'- TTCACAATAGGCTTGCTCAGTAG -3'

Sequencing Primer
(F):5'- CTGGAGTACGTGCGCGAAG -3'
(R):5'- CTCTTCTGCAGGGAAGTGC -3'
Posted On2019-12-27