Incidental Mutation 'R7959:Il1a'
ID613573
Institutional Source Beutler Lab
Gene Symbol Il1a
Ensembl Gene ENSMUSG00000027399
Gene Nameinterleukin 1 alpha
SynonymsIl-1a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7959 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129299610-129309972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129300842 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 228 (W228G)
Ref Sequence ENSEMBL: ENSMUSP00000028882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028882] [ENSMUST00000052708]
Predicted Effect probably damaging
Transcript: ENSMUST00000028882
AA Change: W228G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028882
Gene: ENSMUSG00000027399
AA Change: W228G

DomainStartEndE-ValueType
Pfam:IL1_propep 1 111 2.2e-38 PFAM
IL1 131 270 8.14e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052708
SMART Domains Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:CKAP2_C 425 644 3e-32 PFAM
Pfam:CKAP2_C 675 734 6.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal tumor vascularization, decreased metastatic potential, and decreased interleukin-1 beta secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Il1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Il1a APN 2 129304717 missense probably benign
IGL01726:Il1a APN 2 129304720 missense possibly damaging 0.47
IGL02451:Il1a APN 2 129306655 missense probably damaging 0.98
IGL02537:Il1a APN 2 129309076 missense probably damaging 0.98
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0759:Il1a UTSW 2 129304687 missense probably damaging 1.00
R1388:Il1a UTSW 2 129306581 missense possibly damaging 0.92
R1521:Il1a UTSW 2 129304741 missense possibly damaging 0.83
R1699:Il1a UTSW 2 129302893 missense probably damaging 0.98
R3833:Il1a UTSW 2 129306679 missense possibly damaging 0.81
R4591:Il1a UTSW 2 129306527 missense probably damaging 1.00
R4643:Il1a UTSW 2 129304703 missense probably benign
R5433:Il1a UTSW 2 129307901 missense possibly damaging 0.79
R5572:Il1a UTSW 2 129307918 missense possibly damaging 0.83
R7345:Il1a UTSW 2 129304773 missense probably benign
R7876:Il1a UTSW 2 129300842 missense probably damaging 1.00
R8116:Il1a UTSW 2 129302944 missense probably damaging 1.00
R8162:Il1a UTSW 2 129306557 missense possibly damaging 0.92
R8248:Il1a UTSW 2 129302961 missense probably benign
RF003:Il1a UTSW 2 129302932 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGTACATACAGACTGTCAGCAC -3'
(R):5'- ATGCTTGATGAGTGACCAAATG -3'

Sequencing Primer
(F):5'- GACTGTCAGCACTTCCCAAG -3'
(R):5'- AGGAGTTGCCAGAAACAC -3'
Posted On2019-12-27