Incidental Mutation 'R7959:Pcf11'
ID613591
Institutional Source Beutler Lab
Gene Symbol Pcf11
Ensembl Gene ENSMUSG00000041328
Gene NamePCF11 cleavage and polyadenylation factor subunit
Synonyms2500001H09Rik, 5730417B17Rik
Accession Numbers

Genbank: NM_029078; MGI: 1919579

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7959 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location92643543-92669934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92661326 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 485 (S485A)
Ref Sequence ENSEMBL: ENSMUSP00000113717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119954]
Predicted Effect probably damaging
Transcript: ENSMUST00000119954
AA Change: S485A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113717
Gene: ENSMUSG00000041328
AA Change: S485A

DomainStartEndE-ValueType
RPR 17 139 6.74e-43 SMART
low complexity region 173 194 N/A INTRINSIC
coiled coil region 202 243 N/A INTRINSIC
low complexity region 355 380 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
low complexity region 471 513 N/A INTRINSIC
low complexity region 793 819 N/A INTRINSIC
low complexity region 833 853 N/A INTRINSIC
internal_repeat_1 854 931 1.77e-14 PROSPERO
low complexity region 932 948 N/A INTRINSIC
internal_repeat_1 969 1105 1.77e-14 PROSPERO
low complexity region 1159 1178 N/A INTRINSIC
low complexity region 1294 1315 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115278
Gene: ENSMUSG00000041328
AA Change: S276A

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 147 172 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 263 305 N/A INTRINSIC
low complexity region 716 742 N/A INTRINSIC
low complexity region 756 776 N/A INTRINSIC
internal_repeat_1 777 854 3.34e-13 PROSPERO
low complexity region 855 871 N/A INTRINSIC
internal_repeat_1 892 1028 3.34e-13 PROSPERO
low complexity region 1082 1101 N/A INTRINSIC
low complexity region 1217 1238 N/A INTRINSIC
low complexity region 1368 1381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to CLP1 to form pre-mRNA cleavage factor IIm. The encoded protein is necessary for efficient Pol II transcription termination and may be involved in degradation of the 3' product of polyA site cleavage. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Pcf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Pcf11 APN 7 92661686 missense possibly damaging 0.51
IGL02439:Pcf11 APN 7 92661841 missense possibly damaging 0.93
IGL02658:Pcf11 APN 7 92647046 missense probably damaging 1.00
IGL02702:Pcf11 APN 7 92661618 missense possibly damaging 0.76
3-1:Pcf11 UTSW 7 92658518 missense probably damaging 1.00
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0078:Pcf11 UTSW 7 92669559 missense possibly damaging 0.90
R0110:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R0373:Pcf11 UTSW 7 92661215 missense probably benign
R0450:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R1717:Pcf11 UTSW 7 92663585 missense probably benign 0.00
R1952:Pcf11 UTSW 7 92661338 missense probably damaging 1.00
R1965:Pcf11 UTSW 7 92661601 missense probably benign
R2045:Pcf11 UTSW 7 92661879 missense probably damaging 1.00
R2245:Pcf11 UTSW 7 92665872 unclassified probably benign
R3824:Pcf11 UTSW 7 92659620 intron probably benign
R4439:Pcf11 UTSW 7 92658017 missense probably damaging 0.99
R4517:Pcf11 UTSW 7 92646488 missense probably damaging 1.00
R4671:Pcf11 UTSW 7 92657529 missense possibly damaging 0.62
R4674:Pcf11 UTSW 7 92659777 intron probably benign
R4675:Pcf11 UTSW 7 92659777 intron probably benign
R4732:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4733:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4758:Pcf11 UTSW 7 92661175 missense probably damaging 0.97
R4985:Pcf11 UTSW 7 92661902 missense probably benign 0.01
R5041:Pcf11 UTSW 7 92658405 missense probably benign 0.00
R5248:Pcf11 UTSW 7 92661491 missense probably damaging 1.00
R5688:Pcf11 UTSW 7 92658808 missense possibly damaging 0.92
R5814:Pcf11 UTSW 7 92657714 missense probably benign 0.00
R6240:Pcf11 UTSW 7 92646502 missense probably damaging 1.00
R6327:Pcf11 UTSW 7 92659609 intron probably benign
R6615:Pcf11 UTSW 7 92657882 missense probably damaging 0.96
R6795:Pcf11 UTSW 7 92657578 missense probably benign 0.04
R6896:Pcf11 UTSW 7 92649551 missense probably damaging 0.99
R6902:Pcf11 UTSW 7 92658299 missense probably damaging 0.99
R7030:Pcf11 UTSW 7 92657678 missense probably benign 0.21
R7135:Pcf11 UTSW 7 92657316 missense probably benign 0.05
R7162:Pcf11 UTSW 7 92664013 missense probably damaging 0.97
R7210:Pcf11 UTSW 7 92663476 missense probably benign
R7243:Pcf11 UTSW 7 92660060 missense probably damaging 1.00
R7362:Pcf11 UTSW 7 92653245 missense possibly damaging 0.83
R7876:Pcf11 UTSW 7 92661326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATCTCTAACATCCTGCTTAG -3'
(R):5'- TCTTCAGGATAAAGCTGAGGGC -3'

Sequencing Primer
(F):5'- AACATCCTGCTTAGCACTTCTC -3'
(R):5'- CAGGATAAAGCTGAGGGCAAAGATG -3'
Posted On2019-12-27