Incidental Mutation 'R7959:Nav3'
ID613601
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7959 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109853498 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 306 (N306S)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably benign
Transcript: ENSMUST00000032719
AA Change: N306S

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: N306S

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
R7876:Nav3 UTSW 10 109853498 missense probably benign 0.26
R8048:Nav3 UTSW 10 109764918 missense probably benign 0.13
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACCCCTTCTGTGACAGG -3'
(R):5'- CCCTGAAATTAATGCCTTCCAAAG -3'

Sequencing Primer
(F):5'- ACAGGGGGCTTCAGTCTGTC -3'
(R):5'- CGAGTACACATATTGGCTGGTTCAC -3'
Posted On2019-12-27