Incidental Mutation 'R0690:Abca8b'
ID61363
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0690 (G1)
Quality Score150
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 109969808 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably benign
Transcript: ENSMUST00000020948
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106669
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R8074:Abca8b UTSW 11 109938494 missense probably benign
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCATAGGTTCCTTGATGTTGCCC -3'
(R):5'- TGATGTGCCAACTCTTTCTGAACCC -3'

Sequencing Primer
(F):5'- TGACCTTGTAGATGCAAGACTCC -3'
(R):5'- CTTTCTGAACCCTGAAAATAAGATCC -3'
Posted On2013-07-30