Incidental Mutation 'R7960:Dnajc2'
ID613638
Institutional Source Beutler Lab
Gene Symbol Dnajc2
Ensembl Gene ENSMUSG00000029014
Gene NameDnaJ heat shock protein family (Hsp40) member C2
SynonymsMIDA1, Zrf1, Mida1, Zrf2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R7960 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21757267-21785251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 21760639 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 505 (S505R)
Ref Sequence ENSEMBL: ENSMUSP00000030771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030771] [ENSMUST00000030882] [ENSMUST00000115193] [ENSMUST00000115195]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030771
AA Change: S505R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014
AA Change: S505R

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 281 319 N/A INTRINSIC
Pfam:RAC_head 339 430 2.8e-24 PFAM
SANT 450 509 6.64e-10 SMART
SANT 550 602 2.4e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030882
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115193
AA Change: S505R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014
AA Change: S505R

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
coiled coil region 230 358 N/A INTRINSIC
coiled coil region 404 445 N/A INTRINSIC
SANT 450 509 6.64e-10 SMART
SANT 550 602 1.34e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115195
AA Change: S431R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014
AA Change: S431R

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141022
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hpse2 A T 19: 42,913,214 probably null Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Hspa9 A T 18: 34,942,099 probably null Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Intu G A 3: 40,699,792 V905I probably benign Het
Kctd9 T A 14: 67,738,173 probably null Het
Keg1 A T 19: 12,710,913 probably null Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Rsph3b G T 17: 6,941,759 probably null Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Dnajc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Dnajc2 APN 5 21774976 missense possibly damaging 0.83
IGL01479:Dnajc2 APN 5 21757893 missense probably damaging 1.00
IGL01804:Dnajc2 APN 5 21757363 missense probably damaging 1.00
IGL02478:Dnajc2 APN 5 21776790 missense probably damaging 1.00
IGL02552:Dnajc2 APN 5 21783063 missense probably damaging 1.00
IGL02657:Dnajc2 APN 5 21770481 splice site probably benign
IGL02832:Dnajc2 APN 5 21760410 missense probably benign
IGL03177:Dnajc2 APN 5 21775081 splice site probably benign
R1914:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R1915:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R2024:Dnajc2 UTSW 5 21776790 missense probably damaging 1.00
R2437:Dnajc2 UTSW 5 21760391 missense probably benign 0.06
R4177:Dnajc2 UTSW 5 21757396 missense probably benign 0.28
R4451:Dnajc2 UTSW 5 21757794 missense possibly damaging 0.93
R4812:Dnajc2 UTSW 5 21763486 missense probably benign 0.03
R4916:Dnajc2 UTSW 5 21757340 missense probably damaging 1.00
R5013:Dnajc2 UTSW 5 21757773 nonsense probably null
R5094:Dnajc2 UTSW 5 21776732 missense probably damaging 1.00
R5124:Dnajc2 UTSW 5 21763484 missense probably benign
R5891:Dnajc2 UTSW 5 21761711 missense possibly damaging 0.67
R6192:Dnajc2 UTSW 5 21768648 missense probably damaging 1.00
R6567:Dnajc2 UTSW 5 21766678 missense probably damaging 1.00
R7211:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7216:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7418:Dnajc2 UTSW 5 21760624 critical splice donor site probably null
R7728:Dnajc2 UTSW 5 21770540 missense possibly damaging 0.62
R7877:Dnajc2 UTSW 5 21760639 missense possibly damaging 0.88
RF040:Dnajc2 UTSW 5 21757697 makesense probably null
X0027:Dnajc2 UTSW 5 21773811 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAGAGGCCACTCCATGTTC -3'
(R):5'- GCTAACAGGTCTTAATAGCCTCTACAG -3'

Sequencing Primer
(F):5'- TCTTTTTGATGAGGGTCTAAGAAATG -3'
(R):5'- AGGTCTTAATAGCCTCTACAGTAAAC -3'
Posted On2019-12-27