Incidental Mutation 'R7960:Large1'
ID613660
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene NameLARGE xylosyl- and glucuronyltransferase 1
Synonymsfroggy, BPFD#36, fg, enr
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R7960 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location72814599-73353540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73116443 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 151 (R151W)
Ref Sequence ENSEMBL: ENSMUSP00000004497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
Predicted Effect probably damaging
Transcript: ENSMUST00000004497
AA Change: R151W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: R151W

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119826
AA Change: R151W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: R151W

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212459
AA Change: R151W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hpse2 A T 19: 42,913,214 probably null Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Hspa9 A T 18: 34,942,099 probably null Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Intu G A 3: 40,699,792 V905I probably benign Het
Kctd9 T A 14: 67,738,173 probably null Het
Keg1 A T 19: 12,710,913 probably null Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Rsph3b G T 17: 6,941,759 probably null Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTAATGCTGAACCTCTGC -3'
(R):5'- AATGGCTGTATGCAGGGTC -3'

Sequencing Primer
(F):5'- GGTAATGCTGAACCTCTGCTATTAAG -3'
(R):5'- ATGCAGGGTCCTTGTTTTCTATAATC -3'
Posted On2019-12-27