Incidental Mutation 'R0690:Cldn8'
ID61368
Institutional Source Beutler Lab
Gene Symbol Cldn8
Ensembl Gene ENSMUSG00000050520
Gene Nameclaudin 8
Synonyms
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0690 (G1)
Quality Score164
Status Validated
Chromosome16
Chromosomal Location88560828-88563183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88562639 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 133 (V133M)
Ref Sequence ENSEMBL: ENSMUSP00000051887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049697]
Predicted Effect probably damaging
Transcript: ENSMUST00000049697
AA Change: V133M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051887
Gene: ENSMUSG00000050520
AA Change: V133M

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.9e-32 PFAM
Pfam:Claudin_2 15 184 5.6e-10 PFAM
Meta Mutation Damage Score 0.4264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a paracellular cation barrier. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Cldn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Cldn8 APN 16 88562383 missense probably benign 0.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0332:Cldn8 UTSW 16 88562358 synonymous silent
R1496:Cldn8 UTSW 16 88562401 missense probably benign
R1832:Cldn8 UTSW 16 88562858 missense probably benign 0.07
R3052:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R3053:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4428:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4429:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4430:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4431:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4465:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4485:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4659:Cldn8 UTSW 16 88562408 missense probably benign
R4660:Cldn8 UTSW 16 88562408 missense probably benign
R4662:Cldn8 UTSW 16 88562408 missense probably benign
R4679:Cldn8 UTSW 16 88562408 missense probably benign
R4741:Cldn8 UTSW 16 88562408 missense probably benign
R6591:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
R6691:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
R7684:Cldn8 UTSW 16 88562447 missense probably damaging 1.00
R7959:Cldn8 UTSW 16 88562941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGTACCTGTAACTGTTGCTCC -3'
(R):5'- GCCAACATCAGAATGCAGTGCAAG -3'

Sequencing Primer
(F):5'- GTTGCTCCTTTCAGTACAACAAAAC -3'
(R):5'- CAGTGCAAGGTCTACGACTC -3'
Posted On2013-07-30