Incidental Mutation 'R0690:Nox3'
ID61369
Institutional Source Beutler Lab
Gene Symbol Nox3
Ensembl Gene ENSMUSG00000023802
Gene NameNADPH oxidase 3
Synonymsnmf250, het
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0690 (G1)
Quality Score118
Status Validated
Chromosome17
Chromosomal Location3635240-3696261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3695564 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 23 (N23S)
Ref Sequence ENSEMBL: ENSMUSP00000111466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115800]
Predicted Effect probably damaging
Transcript: ENSMUST00000024565
AA Change: N43S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024565
Gene: ENSMUSG00000023802
AA Change: N43S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Ferric_reduct 75 238 8.6e-28 PFAM
Pfam:FAD_binding_8 311 413 4.1e-26 PFAM
Pfam:NAD_binding_6 419 569 1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115800
AA Change: N23S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111466
Gene: ENSMUSG00000023802
AA Change: N23S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 55 218 5.4e-23 PFAM
Pfam:FAD_binding_6 290 379 1.8e-8 PFAM
Pfam:FAD_binding_8 291 393 1.5e-27 PFAM
Pfam:NAD_binding_6 399 549 1e-34 PFAM
Meta Mutation Damage Score 0.4151 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: This gene encodes a member of the NOX family of NADPH oxidases. These enzymes catalyze the transfer of electrons from NADPH to molecular oxygen to produce superoxide and other reactive oxygen species (ROS). The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia, which are crystalline structures of the inner ear involved in the perception of gravity and linear acceleration. In mouse mutations of this gene lead to the absence of otoconia and vestibular dysfunction. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous mutants bilaterally lack otoliths in otherwise normal ears and display impaired swimming ability, motor capabilities, and vestibular responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Nox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Nox3 APN 17 3683015 missense probably damaging 0.99
IGL01135:Nox3 APN 17 3696252 utr 5 prime probably benign
IGL01791:Nox3 APN 17 3682943 missense possibly damaging 0.68
IGL02423:Nox3 APN 17 3682916 missense probably damaging 1.00
IGL03091:Nox3 APN 17 3665844 missense probably benign 0.42
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0046:Nox3 UTSW 17 3682961 missense probably benign 0.08
R0085:Nox3 UTSW 17 3635281 missense probably benign 0.14
R0426:Nox3 UTSW 17 3695563 missense probably damaging 1.00
R1281:Nox3 UTSW 17 3696185 missense probably damaging 1.00
R1350:Nox3 UTSW 17 3650121 missense probably damaging 1.00
R1843:Nox3 UTSW 17 3669878 missense probably damaging 1.00
R1902:Nox3 UTSW 17 3670017 missense probably damaging 1.00
R2023:Nox3 UTSW 17 3694021 splice site probably benign
R2762:Nox3 UTSW 17 3696158 missense probably benign 0.35
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R2872:Nox3 UTSW 17 3682916 missense probably damaging 1.00
R4429:Nox3 UTSW 17 3682958 missense probably benign 0.05
R4630:Nox3 UTSW 17 3693982 missense possibly damaging 0.53
R4926:Nox3 UTSW 17 3669894 missense probably damaging 1.00
R4928:Nox3 UTSW 17 3635275 missense probably null 1.00
R5181:Nox3 UTSW 17 3635286 nonsense probably null
R6911:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R6912:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R7486:Nox3 UTSW 17 3669944 missense probably damaging 1.00
R7529:Nox3 UTSW 17 3671775 missense probably damaging 0.99
R8355:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8357:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8455:Nox3 UTSW 17 3685923 missense probably damaging 1.00
R8457:Nox3 UTSW 17 3685923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCCAATGCGGACTATCCATAAG -3'
(R):5'- TTTAAAGATGCCCTGACTCTTCACACC -3'

Sequencing Primer
(F):5'- TGAAGCTTGAGAAAGTAGAATGCAT -3'
(R):5'- CCTGTTGACTAAGAAGATCCTGTG -3'
Posted On2013-07-30