Incidental Mutation 'R7960:Ighmbp2'
ID613697
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7960 (G1)
Quality Score186.009
Status Not validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3261490 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 975 (L975P)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025751
AA Change: L975P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: L975P

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119292
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hpse2 A T 19: 42,913,214 probably null Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Hspa9 A T 18: 34,942,099 probably null Het
Intu G A 3: 40,699,792 V905I probably benign Het
Kctd9 T A 14: 67,738,173 probably null Het
Keg1 A T 19: 12,710,913 probably null Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Rsph3b G T 17: 6,941,759 probably null Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7819:Ighmbp2 UTSW 19 3267276 missense possibly damaging 0.46
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3265635 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3267242 missense probably null 1.00
Z1177:Ighmbp2 UTSW 19 3271665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGTAACTAGGCGCATCTCC -3'
(R):5'- CCTTTGATGCAGCTCTGTGG -3'

Sequencing Primer
(F):5'- TAGGCGCATCTCCTCACAAACAG -3'
(R):5'- AGCTCTGTGGGCTTCAGC -3'
Posted On2019-12-27