Incidental Mutation 'R7961:Vmn1r69'
ID613725
Institutional Source Beutler Lab
Gene Symbol Vmn1r69
Ensembl Gene ENSMUSG00000091662
Gene Namevomeronasal 1 receptor 69
SynonymsV1re9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location10578930-10613659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10580790 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 5 (T5S)
Ref Sequence ENSEMBL: ENSMUSP00000154076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163658] [ENSMUST00000176284] [ENSMUST00000176707] [ENSMUST00000226160] [ENSMUST00000226190] [ENSMUST00000226228] [ENSMUST00000227853] [ENSMUST00000228296] [ENSMUST00000228478] [ENSMUST00000228638]
Predicted Effect probably benign
Transcript: ENSMUST00000163658
AA Change: T5S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129646
Gene: ENSMUSG00000091662
AA Change: T5S

DomainStartEndE-ValueType
Pfam:V1R 50 307 3.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176284
AA Change: T5S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000176707
AA Change: T5S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226160
AA Change: T5S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226190
AA Change: T5S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226228
AA Change: T5S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226990
Predicted Effect probably benign
Transcript: ENSMUST00000227853
Predicted Effect probably benign
Transcript: ENSMUST00000228296
Predicted Effect probably benign
Transcript: ENSMUST00000228478
Predicted Effect probably benign
Transcript: ENSMUST00000228638
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Dscam C T 16: 96,709,421 probably null Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Mybpc1 A T 10: 88,537,642 probably null Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pla2g15 A G 8: 106,160,284 probably null Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Vmn1r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn1r69 APN 7 10579952 missense probably benign 0.00
IGL01972:Vmn1r69 APN 7 10580659 nonsense probably null
IGL02339:Vmn1r69 APN 7 10580718 nonsense probably null
IGL02424:Vmn1r69 APN 7 10580658 missense probably benign 0.00
IGL02602:Vmn1r69 APN 7 10579974 missense probably benign 0.14
IGL03271:Vmn1r69 APN 7 10580669 missense probably benign 0.11
R0034:Vmn1r69 UTSW 7 10580811 intron probably benign
R0052:Vmn1r69 UTSW 7 10580400 missense probably benign 0.00
R0096:Vmn1r69 UTSW 7 10580058 missense probably damaging 1.00
R0539:Vmn1r69 UTSW 7 10580947 splice site probably benign
R0604:Vmn1r69 UTSW 7 10580654 missense probably benign 0.00
R1681:Vmn1r69 UTSW 7 10580252 missense probably benign 0.06
R1884:Vmn1r69 UTSW 7 10580751 missense probably benign 0.00
R3741:Vmn1r69 UTSW 7 10580142 missense possibly damaging 0.47
R4655:Vmn1r69 UTSW 7 10580099 missense probably benign 0.03
R4735:Vmn1r69 UTSW 7 10580999 utr 5 prime probably benign
R4758:Vmn1r69 UTSW 7 10580546 missense probably benign 0.00
R5582:Vmn1r69 UTSW 7 10580508 missense probably damaging 1.00
R5966:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R5977:Vmn1r69 UTSW 7 10580490 missense probably damaging 1.00
R6458:Vmn1r69 UTSW 7 10580438 missense probably benign
R6987:Vmn1r69 UTSW 7 10580564 start codon destroyed probably null 0.99
R7133:Vmn1r69 UTSW 7 10581068 intron probably benign
R7532:Vmn1r69 UTSW 7 10580354 missense probably damaging 0.98
R7878:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
Z1176:Vmn1r69 UTSW 7 10580096 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACCATCAAGGCATTCGATGTCAC -3'
(R):5'- ATGTGTATCCTTGGGCCTTCAC -3'

Sequencing Primer
(F):5'- TCGATGTCACTAGGTGCATGAGAATC -3'
(R):5'- GGGCCTTCACCAATATTACAATACTG -3'
Posted On2019-12-27