Incidental Mutation 'R7961:Serpina3g'
ID613746
Institutional Source Beutler Lab
Gene Symbol Serpina3g
Ensembl Gene ENSMUSG00000041481
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3G
SynonymsSpi2-1, 2A2, Spi2A, Spi2/eb.1, alpha-1 antiproteinase,, alpha-1 antiproteinase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location104236245-104241939 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 104238102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043315] [ENSMUST00000170628] [ENSMUST00000171916]
Predicted Effect probably benign
Transcript: ENSMUST00000043315
SMART Domains Protein: ENSMUSP00000041250
Gene: ENSMUSG00000041481

DomainStartEndE-ValueType
SERPIN 1 215 1.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170628
Predicted Effect probably benign
Transcript: ENSMUST00000171916
SMART Domains Protein: ENSMUSP00000129633
Gene: ENSMUSG00000041481

DomainStartEndE-ValueType
Pfam:Serpin 1 101 1.3e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired memory T cell homeostatic proliferation, decreased CD8+ T cells and antigen-specific CD8+ T cells after LCMV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Dscam C T 16: 96,709,421 probably null Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Mybpc1 A T 10: 88,537,642 probably null Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pla2g15 A G 8: 106,160,284 probably null Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Serpina3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Serpina3g APN 12 104241178 missense probably damaging 0.99
IGL02663:Serpina3g APN 12 104239140 missense possibly damaging 0.94
R0047:Serpina3g UTSW 12 104240284 missense possibly damaging 0.69
R0525:Serpina3g UTSW 12 104238339 missense probably damaging 1.00
R0702:Serpina3g UTSW 12 104241253 missense probably damaging 0.96
R1163:Serpina3g UTSW 12 104239292 missense possibly damaging 0.84
R1595:Serpina3g UTSW 12 104239272 missense probably benign 0.16
R1908:Serpina3g UTSW 12 104241277 missense probably damaging 0.96
R2089:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2403:Serpina3g UTSW 12 104241162 missense probably damaging 1.00
R4165:Serpina3g UTSW 12 104240287 missense probably benign 0.00
R4466:Serpina3g UTSW 12 104237923 splice site probably benign
R4669:Serpina3g UTSW 12 104239220 missense probably damaging 1.00
R4735:Serpina3g UTSW 12 104239113 missense probably damaging 1.00
R5423:Serpina3g UTSW 12 104237994 utr 5 prime probably benign
R5552:Serpina3g UTSW 12 104240336 missense probably damaging 0.96
R5605:Serpina3g UTSW 12 104241040 missense probably damaging 1.00
R6384:Serpina3g UTSW 12 104240396 missense probably null 0.34
R6446:Serpina3g UTSW 12 104239082 missense probably damaging 1.00
R7100:Serpina3g UTSW 12 104238311 start gained probably benign
R7869:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7878:Serpina3g UTSW 12 104238102 start gained probably benign
R7952:Serpina3g UTSW 12 104240251 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CATTCAGCATCTGCACTGCC -3'
(R):5'- GTAGTTCACCAGCACCATCAATG -3'

Sequencing Primer
(F):5'- GCATCTGCACTGCCTTGGC -3'
(R):5'- TCAGGCCTGAGATGAGTTCC -3'
Posted On2019-12-27