Incidental Mutation 'R7961:Lima1'
ID613753
Institutional Source Beutler Lab
Gene Symbol Lima1
Ensembl Gene ENSMUSG00000023022
Gene NameLIM domain and actin binding 1
Synonyms3526402A12Rik, 1110021C24Rik, EPLIN, epithelial protein lost in neoplasm
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99778470-99875456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99819550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 192 (V192I)
Ref Sequence ENSEMBL: ENSMUSP00000073371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073691] [ENSMUST00000109024] [ENSMUST00000231121]
Predicted Effect probably benign
Transcript: ENSMUST00000073691
AA Change: V192I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073371
Gene: ENSMUSG00000023022
AA Change: V192I

DomainStartEndE-ValueType
LIM 387 439 5.14e-17 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 747 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109024
AA Change: V32I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104652
Gene: ENSMUSG00000023022
AA Change: V32I

DomainStartEndE-ValueType
LIM 227 279 5.14e-17 SMART
low complexity region 374 386 N/A INTRINSIC
low complexity region 410 427 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
low complexity region 587 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that inhibits actin filament depolymerization and cross-links filaments in bundles. It is downregulated in some cancer cell lines. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and expression of some of the variants maybe independently regulated. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Dscam C T 16: 96,709,421 probably null Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Mybpc1 A T 10: 88,537,642 probably null Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pla2g15 A G 8: 106,160,284 probably null Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Lima1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Lima1 APN 15 99802157 missense possibly damaging 0.47
IGL01104:Lima1 APN 15 99843700 missense probably damaging 1.00
IGL02618:Lima1 APN 15 99802216 splice site probably benign
IGL03124:Lima1 APN 15 99796734 splice site probably benign
R0312:Lima1 UTSW 15 99781087 missense possibly damaging 0.69
R0599:Lima1 UTSW 15 99802159 missense probably damaging 1.00
R0601:Lima1 UTSW 15 99780472 missense probably damaging 0.98
R1423:Lima1 UTSW 15 99819745 nonsense probably null
R1704:Lima1 UTSW 15 99819736 missense probably benign 0.00
R1784:Lima1 UTSW 15 99780463 missense possibly damaging 0.93
R1819:Lima1 UTSW 15 99819936 missense probably benign 0.01
R1968:Lima1 UTSW 15 99819684 missense probably benign
R2352:Lima1 UTSW 15 99794515 missense probably benign 0.02
R2908:Lima1 UTSW 15 99802110 critical splice donor site probably null
R4582:Lima1 UTSW 15 99780992 missense possibly damaging 0.65
R4672:Lima1 UTSW 15 99843709 missense probably damaging 1.00
R4858:Lima1 UTSW 15 99819576 missense probably benign 0.23
R6140:Lima1 UTSW 15 99781058 missense probably damaging 1.00
R6614:Lima1 UTSW 15 99783580 missense probably damaging 1.00
R6898:Lima1 UTSW 15 99781267 missense possibly damaging 0.61
R7598:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7601:Lima1 UTSW 15 99819696 missense probably benign 0.01
R7878:Lima1 UTSW 15 99819550 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATGGGGACTCAAATCTCAGC -3'
(R):5'- CAGTTATCCAGAGCCGGTATC -3'

Sequencing Primer
(F):5'- GAGGCTTTTATGAACACAACTCG -3'
(R):5'- AGAGCCGGTATCCTCGCTC -3'
Posted On2019-12-27