Incidental Mutation 'R7961:Ccbe1'
ID613760
Institutional Source Beutler Lab
Gene Symbol Ccbe1
Ensembl Gene ENSMUSG00000046318
Gene Namecollagen and calcium binding EGF domains 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location66045302-66302739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66076391 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 193 (N193D)
Ref Sequence ENSEMBL: ENSMUSP00000117636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061103] [ENSMUST00000130300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061103
AA Change: N193D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052011
Gene: ENSMUSG00000046318
AA Change: N193D

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 93 134 7.95e0 SMART
EGF_CA 135 176 1.69e-12 SMART
Pfam:Collagen 246 295 7.7e-9 PFAM
Pfam:Collagen 299 337 1.2e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130300
AA Change: N193D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117636
Gene: ENSMUSG00000046318
AA Change: N193D

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 93 134 7.95e0 SMART
EGF_CA 135 176 1.69e-12 SMART
Pfam:Collagen 246 295 7.4e-9 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to function in extracellular matrix remodeling and migration. It is predominantly expressed in the ovary, but down regulated in ovarian cancer cell lines and primary carcinomas, suggesting its role as a tumour suppressor. Mutations in this gene have been associated with Hennekam lymphangiectasia-lymphedema syndrome, a generalized lymphatic dysplasia in humans. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with edema and absence of lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Dscam C T 16: 96,709,421 probably null Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Mybpc1 A T 10: 88,537,642 probably null Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pla2g15 A G 8: 106,160,284 probably null Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Ccbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ccbe1 APN 18 66066727 critical splice donor site probably null
R0032:Ccbe1 UTSW 18 66291652 missense possibly damaging 0.81
R0575:Ccbe1 UTSW 18 66093995 splice site probably benign
R0722:Ccbe1 UTSW 18 66084806 missense probably damaging 1.00
R3122:Ccbe1 UTSW 18 66066829 missense probably benign 0.02
R4642:Ccbe1 UTSW 18 66291583 intron probably benign
R5218:Ccbe1 UTSW 18 66083158 missense probably damaging 1.00
R5334:Ccbe1 UTSW 18 66083245 missense probably damaging 0.99
R5369:Ccbe1 UTSW 18 66061414 missense probably benign 0.00
R5806:Ccbe1 UTSW 18 66076355 nonsense probably null
R5865:Ccbe1 UTSW 18 66083151 missense possibly damaging 0.48
R6752:Ccbe1 UTSW 18 66076307 critical splice donor site probably null
R6763:Ccbe1 UTSW 18 66061388 missense possibly damaging 0.65
R7226:Ccbe1 UTSW 18 66083128 missense probably damaging 1.00
R7807:Ccbe1 UTSW 18 66066757 missense probably damaging 1.00
R7878:Ccbe1 UTSW 18 66076391 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGCGGAACAACTGGAATCC -3'
(R):5'- GAGTCACTATGAAAACCTGAGAAC -3'

Sequencing Primer
(F):5'- GCGGAACAACTGGAATCCATATCTAG -3'
(R):5'- TGAAAACCTGAGAACCATAAAACTG -3'
Posted On2019-12-27