Incidental Mutation 'R7963:Dmrta1'
ID613845
Institutional Source Beutler Lab
Gene Symbol Dmrta1
Ensembl Gene ENSMUSG00000043753
Gene Namedoublesex and mab-3 related transcription factor like family A1
SynonymsDmrt4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location89679436-89694772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89688844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 179 (V179E)
Ref Sequence ENSEMBL: ENSMUSP00000057488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052478
AA Change: V179E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: V179E

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DM 82 135 2.31e-30 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:DMA 314 350 3.3e-21 PFAM
low complexity region 393 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Dmrta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Dmrta1 APN 4 89691913 missense probably benign 0.04
IGL02572:Dmrta1 APN 4 89691558 missense probably benign 0.01
IGL02875:Dmrta1 APN 4 89691748 missense possibly damaging 0.70
IGL02883:Dmrta1 APN 4 89688774 missense probably benign
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0394:Dmrta1 UTSW 4 89692039 missense probably damaging 1.00
R2093:Dmrta1 UTSW 4 89691505 missense probably benign
R2132:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2133:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2401:Dmrta1 UTSW 4 89691616 missense probably benign 0.00
R3694:Dmrta1 UTSW 4 89692178 nonsense probably null
R3695:Dmrta1 UTSW 4 89692178 nonsense probably null
R3891:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3892:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3929:Dmrta1 UTSW 4 89691444 nonsense probably null
R4620:Dmrta1 UTSW 4 89688784 missense probably benign 0.05
R4927:Dmrta1 UTSW 4 89691748 missense probably damaging 1.00
R4982:Dmrta1 UTSW 4 89688564 missense probably damaging 1.00
R5312:Dmrta1 UTSW 4 89692047 missense probably damaging 0.99
R5437:Dmrta1 UTSW 4 89691756 missense possibly damaging 0.71
R5637:Dmrta1 UTSW 4 89688831 missense probably benign
R6185:Dmrta1 UTSW 4 89691768 missense probably damaging 0.97
R6906:Dmrta1 UTSW 4 89691966 missense probably benign 0.06
R7156:Dmrta1 UTSW 4 89688463 missense probably damaging 0.99
R7201:Dmrta1 UTSW 4 89692171 nonsense probably null
R7755:Dmrta1 UTSW 4 89691933 missense probably benign 0.01
R7862:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7880:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
R7945:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
Z1177:Dmrta1 UTSW 4 89688408 missense probably damaging 0.97
Z1177:Dmrta1 UTSW 4 89688454 missense probably benign 0.37
Z1177:Dmrta1 UTSW 4 89688498 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGGAGCGATTACCTCACGG -3'
(R):5'- CCACTCTTAAGGAGCTGCTG -3'

Sequencing Primer
(F):5'- AAGTGCACCCTGATCGC -3'
(R):5'- GCTCGTTTCTACACATTCTTGCAG -3'
Posted On2019-12-27