Incidental Mutation 'R7963:Bmp3'
ID613848
Institutional Source Beutler Lab
Gene Symbol Bmp3
Ensembl Gene ENSMUSG00000029335
Gene Namebone morphogenetic protein 3
Synonyms9530029I04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location98854415-98884396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98872575 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 286 (S286A)
Ref Sequence ENSEMBL: ENSMUSP00000142907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031278] [ENSMUST00000197143] [ENSMUST00000200388]
Predicted Effect probably damaging
Transcript: ENSMUST00000031278
AA Change: S286A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031278
Gene: ENSMUSG00000029335
AA Change: S286A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 34 231 7.9e-9 PFAM
TGFB 366 468 6.17e-60 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197143
AA Change: S286A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142662
Gene: ENSMUSG00000029335
AA Change: S286A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 40 227 1.2e-9 PFAM
TGFB 366 433 5.1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200388
AA Change: S286A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142907
Gene: ENSMUSG00000029335
AA Change: S286A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 40 227 1.4e-9 PFAM
TGFB 366 442 3.9e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein suppresses osteoblast differentiation, and negatively regulates bone density, by modulating TGF-beta receptor availability to other ligands. Homozygous knockout mice for this gene exhibit increased bone density and volume, while overexpression of this gene in a transgenic mouse causes bone defects resulting in spontaneous rib fractures. This gene encodes distinct protein isoforms that may be similarly proteolytically processed. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in increased bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Bmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Bmp3 APN 5 98872379 missense possibly damaging 0.47
IGL02396:Bmp3 APN 5 98872719 missense possibly damaging 0.47
IGL03058:Bmp3 APN 5 98872094 missense probably damaging 1.00
IGL03189:Bmp3 APN 5 98872720 missense probably benign 0.23
IGL03400:Bmp3 APN 5 98872098 missense probably damaging 1.00
PIT4377001:Bmp3 UTSW 5 98879749 missense unknown
R0139:Bmp3 UTSW 5 98879909 missense possibly damaging 0.72
R0653:Bmp3 UTSW 5 98872111 missense probably damaging 1.00
R0881:Bmp3 UTSW 5 98872602 missense possibly damaging 0.95
R1261:Bmp3 UTSW 5 98879926 missense probably damaging 1.00
R1413:Bmp3 UTSW 5 98872405 missense probably damaging 0.98
R1481:Bmp3 UTSW 5 98872470 missense probably damaging 1.00
R3009:Bmp3 UTSW 5 98879837 missense probably damaging 1.00
R4507:Bmp3 UTSW 5 98879774 missense probably damaging 1.00
R4750:Bmp3 UTSW 5 98872558 missense possibly damaging 0.89
R4833:Bmp3 UTSW 5 98855207 missense probably damaging 1.00
R4921:Bmp3 UTSW 5 98872061 missense probably damaging 1.00
R5022:Bmp3 UTSW 5 98872824 missense probably damaging 1.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R6039:Bmp3 UTSW 5 98872350 missense probably benign 0.00
R7179:Bmp3 UTSW 5 98872763 missense probably damaging 1.00
R7448:Bmp3 UTSW 5 98872218 missense probably damaging 0.96
R7880:Bmp3 UTSW 5 98872575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTCCAGAGCACACGAG -3'
(R):5'- TCTGCTCATCAAATTGCAGCG -3'

Sequencing Primer
(F):5'- ACCCAAGAGGATGCTGTTTTTC -3'
(R):5'- ATCAAATTGCAGCGTCTGTC -3'
Posted On2019-12-27