Incidental Mutation 'R7963:Chst13'
ID613851
Institutional Source Beutler Lab
Gene Symbol Chst13
Ensembl Gene ENSMUSG00000056643
Gene Namecarbohydrate (chondroitin 4) sulfotransferase 13
SynonymsChst13, C4ST-3, 1110067M19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90308349-90325185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90325080 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 28 (R28H)
Ref Sequence ENSEMBL: ENSMUSP00000064897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070890
AA Change: R28H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064897
Gene: ENSMUSG00000056643
AA Change: R28H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Sulfotransfer_2 94 328 7.5e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to the C4 hydroxyl of beta-1,4-linked N-acetylgalactosamine (GalNAc) flanked by glucuronic acid residue in chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Zfp787 A G 7: 6,132,191 F354L probably benign Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Chst13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03264:Chst13 APN 6 90309211 nonsense probably null
E0374:Chst13 UTSW 6 90309192 nonsense probably null
PIT4520001:Chst13 UTSW 6 90309185 missense probably benign 0.19
R2301:Chst13 UTSW 6 90318289 missense probably damaging 1.00
R2849:Chst13 UTSW 6 90309158 missense probably benign 0.00
R3522:Chst13 UTSW 6 90318263 missense probably damaging 1.00
R5068:Chst13 UTSW 6 90309569 missense possibly damaging 0.69
R5560:Chst13 UTSW 6 90318269 missense probably damaging 1.00
R5888:Chst13 UTSW 6 90309572 missense probably benign 0.37
R6306:Chst13 UTSW 6 90309278 missense probably damaging 0.99
R6393:Chst13 UTSW 6 90325081 missense possibly damaging 0.91
R6572:Chst13 UTSW 6 90309606 missense probably benign 0.00
R7611:Chst13 UTSW 6 90309017 missense probably damaging 1.00
R7767:Chst13 UTSW 6 90309584 missense possibly damaging 0.91
R7880:Chst13 UTSW 6 90325080 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGAGTCAGACAGTGGTCATC -3'
(R):5'- AGTCAGGCGCGTCTATCTCTAG -3'

Sequencing Primer
(F):5'- TCAGACAGTGGTCATCTCGCC -3'
(R):5'- GCGTCTATCTCTAGCCTGGAG -3'
Posted On2019-12-27