Incidental Mutation 'R7963:Zfp787'
ID613853
Institutional Source Beutler Lab
Gene Symbol Zfp787
Ensembl Gene ENSMUSG00000046792
Gene Namezinc finger protein 787
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6131491-6155997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6132191 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 354 (F354L)
Ref Sequence ENSEMBL: ENSMUSP00000092468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094870] [ENSMUST00000207315]
Predicted Effect probably benign
Transcript: ENSMUST00000094870
AA Change: F354L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092468
Gene: ENSMUSG00000046792
AA Change: F354L

DomainStartEndE-ValueType
low complexity region 41 65 N/A INTRINSIC
ZnF_C2H2 66 88 5.67e-5 SMART
ZnF_C2H2 94 116 9.58e-3 SMART
ZnF_C2H2 122 144 1.84e-4 SMART
ZnF_C2H2 150 172 1.3e-4 SMART
ZnF_C2H2 178 200 6.88e-4 SMART
low complexity region 245 277 N/A INTRINSIC
ZnF_C2H2 280 303 2.36e-2 SMART
ZnF_C2H2 317 339 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207315
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T A 7: 133,909,962 D703V possibly damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Akap13 A G 7: 75,586,216 T180A probably damaging Het
Arhgap31 G A 16: 38,602,725 A993V probably benign Het
Asxl3 C T 18: 22,522,151 P1073S possibly damaging Het
Bmp3 T G 5: 98,872,575 S286A probably damaging Het
Cacna2d4 C T 6: 119,349,155 S1078F probably damaging Het
Cd101 A G 3: 101,007,866 L799P probably benign Het
Chst13 C T 6: 90,325,080 R28H possibly damaging Het
CN725425 T A 15: 91,246,105 C390* probably null Het
Crabp1 C A 9: 54,765,658 C82* probably null Het
Cyp2b23 A C 7: 26,673,134 V352G probably damaging Het
Dmrta1 T A 4: 89,688,844 V179E possibly damaging Het
Ect2l T C 10: 18,136,954 D839G possibly damaging Het
Espnl A T 1: 91,344,766 E616V possibly damaging Het
Fam50b C A 13: 34,746,819 Q93K probably benign Het
Focad C T 4: 88,401,170 R1539C unknown Het
Gm14443 T A 2: 175,169,370 I428L probably benign Het
Gm7030 T A 17: 36,127,869 H210L possibly damaging Het
Gramd1c C G 16: 43,992,076 A193P probably benign Het
Gsn A G 2: 35,283,927 H54R probably damaging Het
Gucy2g T A 19: 55,206,280 I902F probably damaging Het
Heg1 T C 16: 33,719,509 S280P possibly damaging Het
Herc1 G T 9: 66,508,224 R4827L probably damaging Het
Igsf21 A G 4: 140,157,508 C46R probably damaging Het
Kansl1 G T 11: 104,424,153 A353D probably damaging Het
Kcnab3 A G 11: 69,331,464 Y311C probably damaging Het
Kctd18 A G 1: 57,967,619 I24T possibly damaging Het
Lpcat4 C A 2: 112,240,031 H30N probably benign Het
Lrrc4c A G 2: 97,630,798 I590V probably benign Het
Lrrc69 T C 4: 14,703,946 I291M possibly damaging Het
Mphosph8 T A 14: 56,674,778 probably null Het
Nsun6 A C 2: 14,996,379 C455W probably damaging Het
Olfr1112 T A 2: 87,192,090 C134* probably null Het
Olfr1264 A T 2: 90,022,037 F10I probably damaging Het
Olfr832 T G 9: 18,944,728 L27V probably benign Het
Olfr992 G T 2: 85,400,035 S166Y possibly damaging Het
Orc6 T C 8: 85,305,244 I162T probably benign Het
Pex13 A T 11: 23,649,369 S381T probably benign Het
Ppil1 G A 17: 29,261,788 H54Y probably damaging Het
Prrt4 T C 6: 29,170,156 I766V probably benign Het
Rab32 C T 10: 10,546,415 V187M probably damaging Het
Sema5a T A 15: 32,686,808 I1022N probably damaging Het
Sipa1l2 T C 8: 125,464,393 T953A probably damaging Het
Snapc3 T C 4: 83,435,194 S157P probably damaging Het
Spag9 A G 11: 94,071,834 probably null Het
Spink5 A G 18: 43,986,326 R235G probably benign Het
Stx5a G A 19: 8,742,328 G19D probably damaging Het
Taf4 G A 2: 179,935,933 R532* probably null Het
Tbc1d9b G T 11: 50,168,109 probably null Het
Tmpo T A 10: 91,166,030 K106* probably null Het
Vmn1r228 A T 17: 20,776,410 I282N probably damaging Het
Vps13d A T 4: 145,181,114 probably null Het
Zfp703 A G 8: 26,978,690 I51V unknown Het
Znrf2 T C 6: 54,817,347 V111A probably benign Het
Zwint G T 10: 72,657,092 R182L probably benign Het
Other mutations in Zfp787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Zfp787 APN 7 6132298 missense probably damaging 0.99
IGL02721:Zfp787 APN 7 6132464 unclassified probably null
cheater UTSW 7 6133040 missense possibly damaging 0.93
R0063:Zfp787 UTSW 7 6132323 unclassified probably null
R1415:Zfp787 UTSW 7 6132695 missense probably damaging 1.00
R1434:Zfp787 UTSW 7 6132235 missense probably damaging 0.98
R2042:Zfp787 UTSW 7 6132764 missense possibly damaging 0.72
R5657:Zfp787 UTSW 7 6133054 missense probably damaging 1.00
R5919:Zfp787 UTSW 7 6132835 missense probably damaging 0.98
R6306:Zfp787 UTSW 7 6132361 missense probably damaging 1.00
R7273:Zfp787 UTSW 7 6133040 missense possibly damaging 0.93
R7316:Zfp787 UTSW 7 6155524 unclassified probably benign
R7396:Zfp787 UTSW 7 6132107 makesense probably null
R7880:Zfp787 UTSW 7 6132191 missense probably benign 0.00
Z1177:Zfp787 UTSW 7 6132124 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGGCCGCTGTTCCTTTC -3'
(R):5'- CAAGCCGTATGTGTGCATGG -3'

Sequencing Primer
(F):5'- CGGTCTGATTCTCTCTGGGC -3'
(R):5'- CGGGAAGGGTTTTGGGCAC -3'
Posted On2019-12-27